Incidental Mutation 'R4308:Arhgef5'
ID 324096
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission 041659-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4308 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43279498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1180 (A1180V)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: A1180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1180V

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182752
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: A448V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.1309 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTCTGGCATACTCAAATACTCC -3'
(R):5'- AATCAGCTGCAATCTCAATGGC -3'

Sequencing Primer
(F):5'- GGCATACTCAAATACTCCTTGTG -3'
(R):5'- GCTGCAATCTCAATGGCTAAGC -3'
Posted On 2015-06-24