Mutagenetix > Incidental Mutations

Incidental Mutation 'R4308:Arhgef5'

324096

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

041659-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4308 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43279498 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1180 (A1180V)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: A1180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1180V

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: A448V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.1309

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	G	A	13: 81,440,192	T4425M	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Ascc1	T	G	10: 60,013,612	H108Q	probably benign	Het
Bod1l	A	T	5: 41,791,813	S2989T	possibly damaging	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Cyp39a1	T	A	17: 43,730,964		probably null	Het
Dars2	A	G	1: 161,041,721	S653P	probably damaging	Het
Fam208b	A	C	13: 3,569,498	S2244R	probably damaging	Het
Fancm	A	T	12: 65,126,531	K1872N	probably benign	Het
Fktn	C	T	4: 53,724,617		probably benign	Het
Gpr33	A	T	12: 52,023,640	C205*	probably null	Het
Gsdmc2	A	G	15: 63,848,705		probably benign	Het
Il31	A	G	5: 123,480,706	S6P	probably damaging	Het
Iqca	T	C	1: 90,144,897	K87R	probably damaging	Het
Kif15	T	G	9: 123,013,982	H47Q	probably benign	Het
L3mbtl3	C	T	10: 26,282,792	A653T	unknown	Het
Lamb1	T	C	12: 31,329,255	L1737P	probably damaging	Het
Map2k5	C	G	9: 63,235,304	R353S	probably benign	Het
Mical2	C	A	7: 112,331,992	L721I	probably benign	Het
Myo1b	T	C	1: 51,883,109	K37E	probably benign	Het
Myo5b	A	G	18: 74,731,740	D1369G	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Olfr1148	T	C	2: 87,833,270	I77T	probably damaging	Het
Olfr116	C	T	17: 37,623,736	V300I	possibly damaging	Het
Pcdhb1	A	T	18: 37,266,661	D555V	probably benign	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Rnf144b	A	G	13: 47,242,942	N252D	probably damaging	Het
Rnf219	T	A	14: 104,479,593	N448I	probably damaging	Het
Rwdd2b	A	T	16: 87,436,727	W162R	probably damaging	Het
Scaf11	A	G	15: 96,446,515	M19T	probably benign	Het
Sft2d2	A	G	1: 165,188,264	I45T	probably benign	Het
Skint5	A	T	4: 113,483,967	H1371Q	unknown	Het
Tas2r124	A	G	6: 132,754,991	I88V	probably benign	Het
Ubr4	T	C	4: 139,472,509	V4568A	possibly damaging	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Vmn2r18	A	T	5: 151,584,803	Y285*	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het
Zfp983	A	G	17: 21,662,208	I351V	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACTCTGGCATACTCAAATACTCC -3'
(R):5'- AATCAGCTGCAATCTCAATGGC -3'

Sequencing Primer
(F):5'- GGCATACTCAAATACTCCTTGTG -3'
(R):5'- GCTGCAATCTCAATGGCTAAGC -3'

Posted On

2015-06-24