Mutagenetix > Incidental Mutation

Incidental Mutation 'R4308:Mical2'

324098

Institutional Source

Beutler Lab

Gene Symbol

Mical2

Ensembl Gene

ENSMUSG00000038244

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 2

Synonyms

5330438E18Rik

MMRRC Submission

041659-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.392) question?

Stock #

R4308 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112225856-112355194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 112331992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 721 (L721I)

Ref Sequence

ENSEMBL: ENSMUSP00000051163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]

AlphaFold

Q8BML1
Q9D5U9

Predicted Effect

probably benign
Transcript: ENSMUST00000037991
AA Change: L721I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: L721I

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1e-8	PFAM
Pfam:FAD_binding_2	88	127	3.2e-6	PFAM
low complexity region	175	188	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
low complexity region	894	925	N/A	INTRINSIC
LIM	979	1033	9.91e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000050149
AA Change: L721I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: L721I

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1.1e-8	PFAM
Pfam:FAD_binding_2	88	127	1.5e-6	PFAM
Pfam:Pyr_redox_2	88	259	1.3e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	9.91e-10	SMART
low complexity region	918	926	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106648

SMART Domains

Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	9.5e-9	PFAM
Pfam:FAD_binding_2	88	127	1.3e-6	PFAM
Pfam:Pyr_redox_2	88	263	1e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	1.71e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150428

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	G	A	13: 81,440,192	T4425M	probably damaging	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Ascc1	T	G	10: 60,013,612	H108Q	probably benign	Het
Bod1l	A	T	5: 41,791,813	S2989T	possibly damaging	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Cyp39a1	T	A	17: 43,730,964		probably null	Het
Dars2	A	G	1: 161,041,721	S653P	probably damaging	Het
Fam208b	A	C	13: 3,569,498	S2244R	probably damaging	Het
Fancm	A	T	12: 65,126,531	K1872N	probably benign	Het
Fktn	C	T	4: 53,724,617		probably benign	Het
Gpr33	A	T	12: 52,023,640	C205*	probably null	Het
Gsdmc2	A	G	15: 63,848,705		probably benign	Het
Il31	A	G	5: 123,480,706	S6P	probably damaging	Het
Iqca	T	C	1: 90,144,897	K87R	probably damaging	Het
Kif15	T	G	9: 123,013,982	H47Q	probably benign	Het
L3mbtl3	C	T	10: 26,282,792	A653T	unknown	Het
Lamb1	T	C	12: 31,329,255	L1737P	probably damaging	Het
Map2k5	C	G	9: 63,235,304	R353S	probably benign	Het
Myo1b	T	C	1: 51,883,109	K37E	probably benign	Het
Myo5b	A	G	18: 74,731,740	D1369G	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Olfr1148	T	C	2: 87,833,270	I77T	probably damaging	Het
Olfr116	C	T	17: 37,623,736	V300I	possibly damaging	Het
Pcdhb1	A	T	18: 37,266,661	D555V	probably benign	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Rnf144b	A	G	13: 47,242,942	N252D	probably damaging	Het
Rnf219	T	A	14: 104,479,593	N448I	probably damaging	Het
Rwdd2b	A	T	16: 87,436,727	W162R	probably damaging	Het
Scaf11	A	G	15: 96,446,515	M19T	probably benign	Het
Sft2d2	A	G	1: 165,188,264	I45T	probably benign	Het
Skint5	A	T	4: 113,483,967	H1371Q	unknown	Het
Tas2r124	A	G	6: 132,754,991	I88V	probably benign	Het
Ubr4	T	C	4: 139,472,509	V4568A	possibly damaging	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Vmn2r18	A	T	5: 151,584,803	Y285*	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het
Zfp983	A	G	17: 21,662,208	I351V	probably benign	Het

Other mutations in Mical2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Mical2	APN	7	112315072	missense	probably benign	0.00
IGL00934:Mical2	APN	7	112349403	missense	probably damaging	1.00
IGL00941:Mical2	APN	7	112321445	splice site	probably benign
IGL01020:Mical2	APN	7	112315076	splice site	probably benign
IGL01395:Mical2	APN	7	112323585	missense	probably damaging	1.00
IGL01658:Mical2	APN	7	112314998	missense	probably damaging	1.00
IGL02040:Mical2	APN	7	112311406	missense	probably damaging	1.00
IGL02388:Mical2	APN	7	112335413	missense	probably benign
IGL02551:Mical2	APN	7	112323990	missense	probably benign	0.01
IGL02578:Mical2	APN	7	112351373	missense	probably benign	0.05
IGL02751:Mical2	APN	7	112332036	missense	probably benign	0.11
R0101:Mical2	UTSW	7	112336867	missense	possibly damaging	0.86
R0504:Mical2	UTSW	7	112271317	missense	probably benign	0.00
R0594:Mical2	UTSW	7	112318450	missense	probably damaging	0.97
R0609:Mical2	UTSW	7	112321440	splice site	probably null
R1542:Mical2	UTSW	7	112309468	missense	probably damaging	1.00
R1740:Mical2	UTSW	7	112333836	missense	probably benign
R1855:Mical2	UTSW	7	112345282	missense	probably benign	0.21
R2086:Mical2	UTSW	7	112318603	missense	probably benign	0.31
R2136:Mical2	UTSW	7	112271515	missense	possibly damaging	0.72
R2418:Mical2	UTSW	7	112320734	critical splice donor site	probably null
R3053:Mical2	UTSW	7	112311423	missense	probably damaging	1.00
R4663:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R4868:Mical2	UTSW	7	112318624	missense	probably damaging	1.00
R4902:Mical2	UTSW	7	112336900	missense	probably benign
R5112:Mical2	UTSW	7	112320611	missense	probably damaging	1.00
R5487:Mical2	UTSW	7	112320635	missense	probably damaging	1.00
R5563:Mical2	UTSW	7	112314978	missense	probably damaging	1.00
R5817:Mical2	UTSW	7	112323659	missense	probably benign
R5987:Mical2	UTSW	7	112334948	missense	probably benign	0.00
R6087:Mical2	UTSW	7	112318485	nonsense	probably null
R6209:Mical2	UTSW	7	112324086	splice site	probably null
R6311:Mical2	UTSW	7	112323558	missense	probably damaging	1.00
R6319:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R6578:Mical2	UTSW	7	112311445	missense	probably damaging	1.00
R6782:Mical2	UTSW	7	112346761	missense	probably damaging	1.00
R7061:Mical2	UTSW	7	112346801	missense	probably benign	0.10
R7147:Mical2	UTSW	7	112323603	missense	possibly damaging	0.77
R7260:Mical2	UTSW	7	112319794	missense	probably benign	0.10
R7266:Mical2	UTSW	7	112303756	missense	probably damaging	1.00
R7391:Mical2	UTSW	7	112320609	missense	probably damaging	1.00
R7724:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
R7747:Mical2	UTSW	7	112333839	missense	probably benign	0.02
R7818:Mical2	UTSW	7	112345307	missense	probably damaging	1.00
R8022:Mical2	UTSW	7	112303767	missense	probably damaging	1.00
R8429:Mical2	UTSW	7	112345253	missense	probably benign	0.01
R8505:Mical2	UTSW	7	112319800	missense	probably benign	0.02
R8532:Mical2	UTSW	7	112318544	missense	probably damaging	1.00
R8862:Mical2	UTSW	7	112311367	missense	probably damaging	1.00
R8988:Mical2	UTSW	7	112311454	missense	possibly damaging	0.63
R9123:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9127:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9128:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9129:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9187:Mical2	UTSW	7	112303590	nonsense	probably null
R9310:Mical2	UTSW	7	112351713	missense	probably benign	0.45
R9399:Mical2	UTSW	7	112346875	missense	probably damaging	1.00
R9500:Mical2	UTSW	7	112336847	critical splice acceptor site	probably null
R9652:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
R9657:Mical2	UTSW	7	112322599	missense	probably benign	0.37
R9756:Mical2	UTSW	7	112303721	missense	probably damaging	0.99
R9789:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
RF008:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
X0062:Mical2	UTSW	7	112346843	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGAGCATCAGTTCCAGG -3'
(R):5'- ACGTCTGTTACTTCATAACCAGGAG -3'

Sequencing Primer
(F):5'- TGAGCATCAGTTCCAGGACTCATC -3'
(R):5'- TTACTTCATAACCAGGAGGCTGAAG -3'

Posted On

2015-06-24