Incidental Mutation 'R4308:Gpr33'
ID324105
Institutional Source Beutler Lab
Gene Symbol Gpr33
Ensembl Gene ENSMUSG00000035148
Gene NameG protein-coupled receptor 33
Synonyms
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52023003-52028063 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 52023640 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 205 (C205*)
Ref Sequence ENSEMBL: ENSMUSP00000048059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040161]
Predicted Effect probably null
Transcript: ENSMUST00000040161
AA Change: C205*
SMART Domains Protein: ENSMUSP00000048059
Gene: ENSMUSG00000035148
AA Change: C205*

DomainStartEndE-ValueType
Pfam:7tm_1 46 299 3.6e-32 PFAM
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been identified as an orphan chemoattractant G-protein-coupled receptors (GPCR) pseudogene. Studies have shown that the inactivated gene is present as the predominant allele in the human population. A small fraction of the human population has been found to harbor an intact allele.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Gpr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Gpr33 APN 12 52023560 missense probably damaging 0.98
IGL02177:Gpr33 APN 12 52024080 missense probably benign 0.00
IGL03090:Gpr33 APN 12 52024026 missense probably damaging 0.99
R0883:Gpr33 UTSW 12 52023635 missense probably benign 0.17
R1112:Gpr33 UTSW 12 52023372 missense probably damaging 1.00
R1127:Gpr33 UTSW 12 52023469 missense probably damaging 1.00
R1742:Gpr33 UTSW 12 52024262 critical splice acceptor site probably null
R1967:Gpr33 UTSW 12 52024208 missense probably benign
R2208:Gpr33 UTSW 12 52023453 missense probably benign 0.00
R2917:Gpr33 UTSW 12 52023596 missense possibly damaging 0.63
R4725:Gpr33 UTSW 12 52024109 missense probably damaging 1.00
R5616:Gpr33 UTSW 12 52023594 missense probably damaging 0.99
R7055:Gpr33 UTSW 12 52024253 start codon destroyed probably null 0.99
R7272:Gpr33 UTSW 12 52024065 missense probably damaging 0.99
R7419:Gpr33 UTSW 12 52023267 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACATGGTAGGGCATCCAAC -3'
(R):5'- TTCATCCAGTGTGGTCCCAG -3'

Sequencing Primer
(F):5'- GGTAGGGCATCCAACACACAAAG -3'
(R):5'- GGCTTCCCGGATTGCCTTG -3'
Posted On2015-06-24