Mutagenetix > Incidental Mutations

Incidental Mutation 'R4308:Fam208b'

324107

Institutional Source

Beutler Lab

Gene Symbol

Fam208b

Ensembl Gene

ENSMUSG00000033799

Gene Name

family with sequence similarity 208, member B

Synonyms

BC016423

MMRRC Submission

041659-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R4308 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3566035-3611108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 3569498 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 2244 (S2244R)

Ref Sequence

ENSEMBL: ENSMUSP00000093774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000223396]

Predicted Effect

probably benign
Transcript: ENSMUST00000059515

SMART Domains

Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218

Domain	Start	End	E-Value	Type
Pfam:GDI	1	436	4.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000096069
AA Change: S2244R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: S2244R

Domain	Start	End	E-Value	Type
Pfam:DUF3699	91	167	1.4e-24	PFAM
low complexity region	272	282	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
Pfam:DUF3715	533	695	2.3e-25	PFAM
low complexity region	1156	1168	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	2012	2021	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221059

Predicted Effect

probably benign
Transcript: ENSMUST00000221581

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222615

Predicted Effect

unknown
Transcript: ENSMUST00000222909
AA Change: S1562R

Predicted Effect

probably benign
Transcript: ENSMUST00000223396

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	G	A	13: 81,440,192	T4425M	probably damaging	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Ascc1	T	G	10: 60,013,612	H108Q	probably benign	Het
Bod1l	A	T	5: 41,791,813	S2989T	possibly damaging	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Cyp39a1	T	A	17: 43,730,964		probably null	Het
Dars2	A	G	1: 161,041,721	S653P	probably damaging	Het
Fancm	A	T	12: 65,126,531	K1872N	probably benign	Het
Fktn	C	T	4: 53,724,617		probably benign	Het
Gpr33	A	T	12: 52,023,640	C205*	probably null	Het
Gsdmc2	A	G	15: 63,848,705		probably benign	Het
Il31	A	G	5: 123,480,706	S6P	probably damaging	Het
Iqca	T	C	1: 90,144,897	K87R	probably damaging	Het
Kif15	T	G	9: 123,013,982	H47Q	probably benign	Het
L3mbtl3	C	T	10: 26,282,792	A653T	unknown	Het
Lamb1	T	C	12: 31,329,255	L1737P	probably damaging	Het
Map2k5	C	G	9: 63,235,304	R353S	probably benign	Het
Mical2	C	A	7: 112,331,992	L721I	probably benign	Het
Myo1b	T	C	1: 51,883,109	K37E	probably benign	Het
Myo5b	A	G	18: 74,731,740	D1369G	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Olfr1148	T	C	2: 87,833,270	I77T	probably damaging	Het
Olfr116	C	T	17: 37,623,736	V300I	possibly damaging	Het
Pcdhb1	A	T	18: 37,266,661	D555V	probably benign	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Rnf144b	A	G	13: 47,242,942	N252D	probably damaging	Het
Rnf219	T	A	14: 104,479,593	N448I	probably damaging	Het
Rwdd2b	A	T	16: 87,436,727	W162R	probably damaging	Het
Scaf11	A	G	15: 96,446,515	M19T	probably benign	Het
Sft2d2	A	G	1: 165,188,264	I45T	probably benign	Het
Skint5	A	T	4: 113,483,967	H1371Q	unknown	Het
Tas2r124	A	G	6: 132,754,991	I88V	probably benign	Het
Ubr4	T	C	4: 139,472,509	V4568A	possibly damaging	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Vmn2r18	A	T	5: 151,584,803	Y285*	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het
Zfp983	A	G	17: 21,662,208	I351V	probably benign	Het

Other mutations in Fam208b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Fam208b	APN	13	3574832	missense	probably benign
IGL00670:Fam208b	APN	13	3585241	missense	probably benign	0.14
IGL00957:Fam208b	APN	13	3577101	missense	possibly damaging	0.86
IGL01311:Fam208b	APN	13	3575885	missense	possibly damaging	0.85
IGL01318:Fam208b	APN	13	3575067	missense	possibly damaging	0.66
IGL01767:Fam208b	APN	13	3576633	missense	probably benign	0.00
IGL02073:Fam208b	APN	13	3574721	missense	probably benign	0.01
IGL02152:Fam208b	APN	13	3585371	missense	probably benign
IGL02431:Fam208b	APN	13	3574736	missense	possibly damaging	0.85
IGL02478:Fam208b	APN	13	3574661	missense	probably benign	0.12
IGL02732:Fam208b	APN	13	3573626	missense	probably benign	0.09
IGL02745:Fam208b	APN	13	3585140	missense	probably benign	0.23
IGL02800:Fam208b	APN	13	3585154	missense	probably benign
IGL02989:Fam208b	APN	13	3584820	missense	probably benign	0.01
IGL03124:Fam208b	APN	13	3574704	missense	probably benign	0.41
IGL03154:Fam208b	APN	13	3575255	missense	possibly damaging	0.56
IGL03216:Fam208b	APN	13	3574553	missense	probably damaging	0.98
H8562:Fam208b	UTSW	13	3577000	missense	probably damaging	0.98
PIT4585001:Fam208b	UTSW	13	3574979	missense	possibly damaging	0.55
R0016:Fam208b	UTSW	13	3585170	unclassified	probably null
R0016:Fam208b	UTSW	13	3585170	unclassified	probably null
R0157:Fam208b	UTSW	13	3575550	missense	probably benign	0.06
R0375:Fam208b	UTSW	13	3596842	missense	possibly damaging	0.85
R0403:Fam208b	UTSW	13	3582052	nonsense	probably null
R0472:Fam208b	UTSW	13	3588364	missense	possibly damaging	0.93
R0517:Fam208b	UTSW	13	3566964	missense	possibly damaging	0.94
R0586:Fam208b	UTSW	13	3590321	missense	probably damaging	0.99
R0600:Fam208b	UTSW	13	3576054	missense	probably benign
R0659:Fam208b	UTSW	13	3574448	missense	probably damaging	0.99
R1257:Fam208b	UTSW	13	3575049	missense	probably benign	0.25
R1375:Fam208b	UTSW	13	3576029	missense	probably benign	0.06
R1443:Fam208b	UTSW	13	3575543	missense	probably benign	0.00
R1497:Fam208b	UTSW	13	3570409	missense	probably damaging	0.96
R1544:Fam208b	UTSW	13	3590413	missense	possibly damaging	0.68
R1554:Fam208b	UTSW	13	3576374	missense	possibly damaging	0.85
R1629:Fam208b	UTSW	13	3574121	missense	possibly damaging	0.84
R1633:Fam208b	UTSW	13	3581771	missense	possibly damaging	0.53
R1661:Fam208b	UTSW	13	3573860	missense	possibly damaging	0.63
R1673:Fam208b	UTSW	13	3584498	critical splice donor site	probably null
R1675:Fam208b	UTSW	13	3569507	missense	possibly damaging	0.65
R1781:Fam208b	UTSW	13	3584759	missense	possibly damaging	0.95
R1792:Fam208b	UTSW	13	3590559	missense	possibly damaging	0.91
R1826:Fam208b	UTSW	13	3581759	missense	probably damaging	0.98
R1920:Fam208b	UTSW	13	3576612	missense	possibly damaging	0.63
R1983:Fam208b	UTSW	13	3574853	missense	possibly damaging	0.92
R2016:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2017:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2220:Fam208b	UTSW	13	3581872	missense	probably benign	0.00
R2513:Fam208b	UTSW	13	3582150	missense	possibly damaging	0.53
R2898:Fam208b	UTSW	13	3585122	missense	possibly damaging	0.82
R2904:Fam208b	UTSW	13	3582185	missense	possibly damaging	0.53
R3149:Fam208b	UTSW	13	3574359	missense	probably damaging	0.98
R3623:Fam208b	UTSW	13	3595556	missense	probably benign
R3624:Fam208b	UTSW	13	3595556	missense	probably benign
R3725:Fam208b	UTSW	13	3590538	missense	probably benign	0.33
R3835:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R3890:Fam208b	UTSW	13	3596785	missense	probably damaging	0.96
R4023:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4024:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4025:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4050:Fam208b	UTSW	13	3573507	missense	probably benign	0.09
R4484:Fam208b	UTSW	13	3581831	missense	probably benign	0.12
R4674:Fam208b	UTSW	13	3573686	missense	possibly damaging	0.69
R4718:Fam208b	UTSW	13	3574495	missense	probably benign	0.00
R4745:Fam208b	UTSW	13	3590069	missense	probably benign	0.26
R4776:Fam208b	UTSW	13	3570391	missense	probably damaging	1.00
R4839:Fam208b	UTSW	13	3584807	missense	probably damaging	0.96
R4855:Fam208b	UTSW	13	3566680	splice site	probably null
R5049:Fam208b	UTSW	13	3574000	missense	probably benign	0.00
R5076:Fam208b	UTSW	13	3576357	missense	probably benign	0.41
R5287:Fam208b	UTSW	13	3575744	missense	probably benign	0.41
R5298:Fam208b	UTSW	13	3595613	splice site	probably null
R5379:Fam208b	UTSW	13	3588496	missense	probably benign	0.41
R5512:Fam208b	UTSW	13	3595517	missense	probably damaging	0.99
R5624:Fam208b	UTSW	13	3584996	missense	possibly damaging	0.66
R5750:Fam208b	UTSW	13	3573642	nonsense	probably null
R6114:Fam208b	UTSW	13	3590081	missense	probably damaging	1.00
R6118:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6119:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6269:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6270:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6271:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6272:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6525:Fam208b	UTSW	13	3576540	nonsense	probably null
R6550:Fam208b	UTSW	13	3590519	missense	possibly damaging	0.85
R6714:Fam208b	UTSW	13	3594189	missense	probably benign	0.00
R6797:Fam208b	UTSW	13	3576769	missense	probably benign	0.26
R6967:Fam208b	UTSW	13	3574819	missense	probably benign	0.22
R7016:Fam208b	UTSW	13	3576857	missense	possibly damaging	0.92
R7219:Fam208b	UTSW	13	3590521	missense	probably damaging	0.99
R7454:Fam208b	UTSW	13	3585332	missense	probably benign	0.21
R7570:Fam208b	UTSW	13	3573621	missense	probably damaging	0.99
R7571:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R7580:Fam208b	UTSW	13	3574752	missense	probably damaging	0.99
R7587:Fam208b	UTSW	13	3568849	missense	possibly damaging	0.83
R7657:Fam208b	UTSW	13	3573777	missense	probably damaging	0.98
X0024:Fam208b	UTSW	13	3599837	missense	probably null	0.99
X0025:Fam208b	UTSW	13	3576827	missense	probably benign	0.15
X0066:Fam208b	UTSW	13	3588441	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CCACAAACTATTCTATCTGGTCATG -3'
(R):5'- AATTGTTGCCTGCATGTGCC -3'

Sequencing Primer
(F):5'- TGCAAAGCCTTGGTATCTAGC -3'
(R):5'- GCATGTGCCTTTCCTTATGGAAGTC -3'

Posted On

2015-06-24