Incidental Mutation 'R4308:Rwdd2b'
ID324114
Institutional Source Beutler Lab
Gene Symbol Rwdd2b
Ensembl Gene ENSMUSG00000041079
Gene NameRWD domain containing 2B
SynonymsORF5
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87433407-87440573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87436727 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 162 (W162R)
Ref Sequence ENSEMBL: ENSMUSP00000049168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039101] [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably damaging
Transcript: ENSMUST00000039101
AA Change: W162R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049168
Gene: ENSMUSG00000041079
AA Change: W162R

DomainStartEndE-ValueType
RWD 12 136 3.17e-24 SMART
Pfam:DUF1115 162 284 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039449
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231843
Predicted Effect probably benign
Transcript: ENSMUST00000232095
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Rwdd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Rwdd2b APN 16 87436940 unclassified probably benign
IGL02351:Rwdd2b APN 16 87437448 missense probably benign 0.06
IGL02358:Rwdd2b APN 16 87437448 missense probably benign 0.06
R1022:Rwdd2b UTSW 16 87436850 missense probably damaging 1.00
R1024:Rwdd2b UTSW 16 87436850 missense probably damaging 1.00
R1086:Rwdd2b UTSW 16 87436558 unclassified probably benign
R1886:Rwdd2b UTSW 16 87437125 missense probably benign 0.08
R2359:Rwdd2b UTSW 16 87436921 missense probably benign 0.06
R4495:Rwdd2b UTSW 16 87434562 missense probably benign 0.00
R4680:Rwdd2b UTSW 16 87437062 critical splice donor site probably null
R4943:Rwdd2b UTSW 16 87434534 missense possibly damaging 0.54
R6260:Rwdd2b UTSW 16 87434468 missense probably damaging 1.00
R7622:Rwdd2b UTSW 16 87434612 missense probably benign 0.03
R7768:Rwdd2b UTSW 16 87436745 missense probably benign 0.01
RF022:Rwdd2b UTSW 16 87436670 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATGTGCTATGTAATACAGGTG -3'
(R):5'- TTCCCATCAGATCAGTATCGCTG -3'

Sequencing Primer
(F):5'- GTGCTATGTAATACAGGTGAAACC -3'
(R):5'- TATCGCTGAGTAGATCCCAGCAG -3'
Posted On2015-06-24