Incidental Mutation 'R4308:Zfp983'
ID324115
Institutional Source Beutler Lab
Gene Symbol Zfp983
Ensembl Gene ENSMUSG00000035868
Gene Namezinc finger protein 983
Synonyms3110052M02Rik
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21657582-21662540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21662208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 351 (I351V)
Ref Sequence ENSEMBL: ENSMUSP00000039392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039726]
Predicted Effect probably benign
Transcript: ENSMUST00000039726
AA Change: I351V

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039392
Gene: ENSMUSG00000035868
AA Change: I351V

DomainStartEndE-ValueType
KRAB 13 73 2.42e-22 SMART
ZnF_C2H2 185 207 5.5e-3 SMART
ZnF_C2H2 213 235 5.14e-3 SMART
ZnF_C2H2 241 263 4.54e-4 SMART
ZnF_C2H2 269 291 7.9e-4 SMART
ZnF_C2H2 297 319 2.86e-1 SMART
ZnF_C2H2 325 347 6.88e-4 SMART
ZnF_C2H2 353 375 1.95e-3 SMART
ZnF_C2H2 381 403 1.04e-3 SMART
ZnF_C2H2 409 431 2.79e-4 SMART
ZnF_C2H2 437 459 3.63e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Zfp983
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL02492:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL03145:Zfp983 APN 17 21659008 missense probably damaging 0.99
R0257:Zfp983 UTSW 17 21661440 missense probably benign 0.35
R1518:Zfp983 UTSW 17 21662353 missense probably damaging 1.00
R1925:Zfp983 UTSW 17 21662017 missense probably damaging 1.00
R2504:Zfp983 UTSW 17 21658967 missense probably damaging 1.00
R3701:Zfp983 UTSW 17 21661539 missense probably damaging 1.00
R5648:Zfp983 UTSW 17 21659031 missense probably damaging 1.00
R6029:Zfp983 UTSW 17 21662485 missense probably benign 0.03
R6188:Zfp983 UTSW 17 21659019 missense probably damaging 1.00
R6662:Zfp983 UTSW 17 21662085 missense probably damaging 1.00
R7313:Zfp983 UTSW 17 21661497 missense probably damaging 0.97
R7361:Zfp983 UTSW 17 21661934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTATAACCGGTGTGCAAATCT -3'
(R):5'- TGAGTAAAGGACTTGTCACATTCCAT -3'

Sequencing Primer
(F):5'- GTGGAAAGTCATTTCGTCAAACCTCC -3'
(R):5'- GGACTTGTCACATTCCATACATTTG -3'
Posted On2015-06-24