Incidental Mutation 'R0004:Cd180'
ID32412
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0004 (G1)
Quality Score204
Status Validated (trace)
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102702708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 33 (V33G)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022124
AA Change: V33G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: V33G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
AA Change: V33G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624
AA Change: V33G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
AA Change: V33G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624
AA Change: V33G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7338:Cd180 UTSW 13 102706428 missense probably benign 0.04
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTGTTCACCTAGACGCATACC -3'
(R):5'- GGGCACTCAAGGAACTGAAATACCTAC -3'

Sequencing Primer
(F):5'- acctcctgtttctctctccc -3'
(R):5'- CCTACCTGGTTAAATCCAGGAAGG -3'
Posted On2013-05-09