Incidental Mutation 'R4319:Pygb'
ID 324124
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Name brain glycogen phosphorylase
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R4319 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 150786735-150831758 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 150815614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
AlphaFold Q8CI94
Predicted Effect probably benign
Transcript: ENSMUST00000045441
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154366
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150819913 missense probably benign 0.00
IGL01395:Pygb APN 2 150801583 missense probably benign 0.04
IGL01571:Pygb APN 2 150830473 missense probably benign 0.00
IGL01960:Pygb APN 2 150813483 missense probably benign 0.00
IGL03118:Pygb APN 2 150820811 missense probably benign 0.01
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0423:Pygb UTSW 2 150823984 missense probably benign
R0545:Pygb UTSW 2 150815706 missense probably benign 0.00
R0674:Pygb UTSW 2 150815134 splice site probably null
R1052:Pygb UTSW 2 150786938 missense probably benign 0.00
R1590:Pygb UTSW 2 150817663 missense possibly damaging 0.94
R1706:Pygb UTSW 2 150827147 missense probably damaging 1.00
R1786:Pygb UTSW 2 150816772 missense probably damaging 0.98
R2405:Pygb UTSW 2 150820775 missense probably benign 0.04
R3522:Pygb UTSW 2 150828553 missense probably benign 0.07
R4082:Pygb UTSW 2 150826471 critical splice donor site probably null
R4662:Pygb UTSW 2 150815116 missense probably benign
R5072:Pygb UTSW 2 150801578 missense probably damaging 1.00
R5665:Pygb UTSW 2 150820888 splice site probably null
R5874:Pygb UTSW 2 150786878 missense probably benign 0.11
R5910:Pygb UTSW 2 150815700 missense probably benign 0.00
R6610:Pygb UTSW 2 150823966 splice site probably null
R6820:Pygb UTSW 2 150816754 missense possibly damaging 0.88
R7348:Pygb UTSW 2 150786983 missense probably benign 0.10
R7920:Pygb UTSW 2 150787002 missense possibly damaging 0.92
R7936:Pygb UTSW 2 150815669 missense probably benign 0.28
R9226:Pygb UTSW 2 150820861 missense possibly damaging 0.58
R9308:Pygb UTSW 2 150826377 missense probably benign 0.15
R9618:Pygb UTSW 2 150815088 missense
Predicted Primers PCR Primer
(F):5'- TCACCTTCTCAGAGCAGAGC -3'
(R):5'- AGCTTGAAGTCTAACGAGGATG -3'

Sequencing Primer
(F):5'- AGAGCTGCTCTTGGGACACATC -3'
(R):5'- CTTGAAGTCTAACGAGGATGCCATC -3'
Posted On 2015-06-24