Incidental Mutation 'R4319:Atxn7l2'
ID324125
Institutional Source Beutler Lab
Gene Symbol Atxn7l2
Ensembl Gene ENSMUSG00000048997
Gene Nameataxin 7-like 2
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108202222-108210934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108205832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 218 (D218E)
Ref Sequence ENSEMBL: ENSMUSP00000113020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065664] [ENSMUST00000102633] [ENSMUST00000106655] [ENSMUST00000117409] [ENSMUST00000117784] [ENSMUST00000119650] [ENSMUST00000127157]
Predicted Effect probably benign
Transcript: ENSMUST00000065664
SMART Domains Protein: ENSMUSP00000070361
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102633
AA Change: D253E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099693
Gene: ENSMUSG00000048997
AA Change: D253E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 198 265 3.9e-29 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106655
SMART Domains Protein: ENSMUSP00000102266
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
B561 54 185 4.96e-47 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117409
AA Change: D221E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112976
Gene: ENSMUSG00000048997
AA Change: D221E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 164 235 1.2e-31 PFAM
low complexity region 301 320 N/A INTRINSIC
low complexity region 324 331 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117784
AA Change: D253E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114031
Gene: ENSMUSG00000048997
AA Change: D253E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 196 267 1.6e-31 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119650
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113020
Gene: ENSMUSG00000048997
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
Pfam:SCA7 161 232 1.2e-31 PFAM
low complexity region 298 317 N/A INTRINSIC
low complexity region 321 328 N/A INTRINSIC
low complexity region 400 417 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127157
SMART Domains Protein: ENSMUSP00000119223
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
Blast:ZnF_C2H2 23 45 1e-5 BLAST
low complexity region 55 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196823
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Atxn7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Atxn7l2 APN 3 108203543 missense probably damaging 1.00
IGL02381:Atxn7l2 APN 3 108204495 unclassified probably benign
IGL03179:Atxn7l2 APN 3 108203647 nonsense probably null
R0610:Atxn7l2 UTSW 3 108204774 missense possibly damaging 0.80
R1454:Atxn7l2 UTSW 3 108208432 unclassified probably benign
R2474:Atxn7l2 UTSW 3 108203977 missense probably damaging 0.96
R4322:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4324:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4797:Atxn7l2 UTSW 3 108204550 missense probably damaging 1.00
R5825:Atxn7l2 UTSW 3 108204811 missense probably damaging 1.00
R5916:Atxn7l2 UTSW 3 108205662 unclassified probably null
R7706:Atxn7l2 UTSW 3 108207403 missense probably damaging 0.98
Z1176:Atxn7l2 UTSW 3 108205666 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTACGGATAGGTCTGCTTAG -3'
(R):5'- TCCAGATCCCTTACCCAGAG -3'

Sequencing Primer
(F):5'- TACGGATAGGTCTGCTTAGACAGAG -3'
(R):5'- CCTTACCCAGAGGAGAGTTTTCG -3'
Posted On2015-06-24