Incidental Mutation 'R4319:Mcoln2'
ID324127
Institutional Source Beutler Lab
Gene Symbol Mcoln2
Ensembl Gene ENSMUSG00000011008
Gene Namemucolipin 2
Synonymsmucolipidin 2, TRPML2, 3300002C04Rik
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146149833-146195513 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 146150011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011152] [ENSMUST00000098524]
Predicted Effect probably null
Transcript: ENSMUST00000011152
SMART Domains Protein: ENSMUSP00000011152
Gene: ENSMUSG00000011008

DomainStartEndE-ValueType
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 340 362 N/A INTRINSIC
Pfam:PKD_channel 370 513 5.8e-12 PFAM
low complexity region 546 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098524
SMART Domains Protein: ENSMUSP00000096125
Gene: ENSMUSG00000011008

DomainStartEndE-ValueType
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Pfam:PKD_channel 343 485 6.9e-11 PFAM
low complexity region 518 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169533
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced chemokine production in bone marrow-derived macrophages and impaired recruitment of peripheral macrophages in response to i.p. injections of LPS or live bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Mcoln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mcoln2 APN 3 146163527 splice site probably benign
IGL01370:Mcoln2 APN 3 146181830 missense possibly damaging 0.71
IGL01479:Mcoln2 APN 3 146175652 splice site probably benign
IGL02629:Mcoln2 APN 3 146170044 missense probably benign 0.28
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0109:Mcoln2 UTSW 3 146175718 missense probably damaging 1.00
R0458:Mcoln2 UTSW 3 146150013 unclassified probably benign
R1335:Mcoln2 UTSW 3 146180174 missense probably benign 0.00
R1440:Mcoln2 UTSW 3 146190382 nonsense probably null
R1452:Mcoln2 UTSW 3 146181814 missense possibly damaging 0.92
R1459:Mcoln2 UTSW 3 146192224 splice site probably null
R1510:Mcoln2 UTSW 3 146176610 missense probably benign 0.02
R1603:Mcoln2 UTSW 3 146180222 missense probably damaging 1.00
R1652:Mcoln2 UTSW 3 146163635 missense possibly damaging 0.48
R1718:Mcoln2 UTSW 3 146190474 splice site probably benign
R1826:Mcoln2 UTSW 3 146175472 missense possibly damaging 0.69
R4719:Mcoln2 UTSW 3 146175713 missense probably benign 0.00
R4939:Mcoln2 UTSW 3 146192241 missense probably benign 0.07
R5475:Mcoln2 UTSW 3 146183786 missense probably damaging 1.00
R5718:Mcoln2 UTSW 3 146181826 missense probably damaging 1.00
R5906:Mcoln2 UTSW 3 146183741 missense probably damaging 1.00
R6911:Mcoln2 UTSW 3 146192256 missense probably damaging 1.00
R6963:Mcoln2 UTSW 3 146172035 missense probably damaging 1.00
R7142:Mcoln2 UTSW 3 146183569 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTATAAGGGCGTCCACTCCACC -3'
(R):5'- CCCAAATGAAAGCCTTAGGGG -3'

Sequencing Primer
(F):5'- GTCCACTCCACCTGCATCTCG -3'
(R):5'- CTTTGCGGAAAAGCGGCTG -3'
Posted On2015-06-24