Incidental Mutation 'R4319:Gm15448'
ID324130
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3822755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000104260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably benign
Transcript: ENSMUST00000094911
AA Change: S372P

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108619
AA Change: S372P
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108620
AA Change: S372P

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: S372P
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189095
AA Change: S372P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
Predicted Primers PCR Primer
(F):5'- TAGGGCCTCAGAAAATGTTTGG -3'
(R):5'- ACACTGGGATGGTGTGAGAC -3'

Sequencing Primer
(F):5'- TTGGAGAATGATAGTGGGGACTTACC -3'
(R):5'- ATGTAAGAGACGACCTCCTTCTC -3'
Posted On2015-06-24