Incidental Mutation 'R4319:Spty2d1'
ID324132
Institutional Source Beutler Lab
Gene Symbol Spty2d1
Ensembl Gene ENSMUSG00000049516
Gene NameSPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Synonyms5830435K17Rik
MMRRC Submission 041660-MU
Accession Numbers

Genbank: NM_175318; MGI: 2142062

Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46990396-47008411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46998135 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 349 (S349G)
Ref Sequence ENSEMBL: ENSMUSP00000059457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061639]
Predicted Effect probably damaging
Transcript: ENSMUST00000061639
AA Change: S349G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059457
Gene: ENSMUSG00000049516
AA Change: S349G

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
coiled coil region 45 82 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 199 215 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
internal_repeat_1 283 336 4.09e-5 PROSPERO
low complexity region 338 353 N/A INTRINSIC
internal_repeat_1 366 420 4.09e-5 PROSPERO
low complexity region 434 468 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
SPT2 573 680 1.3e-32 SMART
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Spty2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Spty2d1 APN 7 46998987 missense probably damaging 1.00
IGL01763:Spty2d1 APN 7 46999848 missense probably damaging 0.99
IGL01988:Spty2d1 APN 7 46997610 missense probably damaging 0.99
IGL02149:Spty2d1 APN 7 47008144 utr 5 prime probably benign
IGL02236:Spty2d1 APN 7 46997612 missense probably benign 0.02
IGL02273:Spty2d1 APN 7 46997573 missense probably damaging 0.97
3-1:Spty2d1 UTSW 7 46998677 missense probably damaging 1.00
R0184:Spty2d1 UTSW 7 46997574 missense possibly damaging 0.94
R0201:Spty2d1 UTSW 7 46997901 nonsense probably null
R1592:Spty2d1 UTSW 7 46998889 missense possibly damaging 0.56
R2116:Spty2d1 UTSW 7 46996185 missense probably damaging 1.00
R2171:Spty2d1 UTSW 7 46994613 missense probably damaging 1.00
R2898:Spty2d1 UTSW 7 46993352 missense unknown
R3857:Spty2d1 UTSW 7 46998296 missense probably benign 0.04
R4080:Spty2d1 UTSW 7 46998581 missense probably damaging 0.99
R4732:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R4733:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R5317:Spty2d1 UTSW 7 46998301 missense possibly damaging 0.61
R5485:Spty2d1 UTSW 7 46997885 missense possibly damaging 0.76
R5711:Spty2d1 UTSW 7 46998097 missense possibly damaging 0.84
R5761:Spty2d1 UTSW 7 46998284 missense probably damaging 1.00
R6418:Spty2d1 UTSW 7 46998003 missense probably damaging 1.00
R7182:Spty2d1 UTSW 7 46998523 missense probably benign 0.09
R7372:Spty2d1 UTSW 7 46998944 missense probably damaging 1.00
R7798:Spty2d1 UTSW 7 46996056 missense probably damaging 1.00
R8229:Spty2d1 UTSW 7 46997774 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGAGATGTGAATTGCTGGCC -3'
(R):5'- AAGCAGCTTTGTCTTCACCC -3'

Sequencing Primer
(F):5'- GCTGACTGCTCAGGTCCTG -3'
(R):5'- AAATCCCTGCCAGGCGAGAG -3'
Posted On2015-06-24