Incidental Mutation 'R4319:Ufsp2'
ID324134
Institutional Source Beutler Lab
Gene Symbol Ufsp2
Ensembl Gene ENSMUSG00000031634
Gene NameUFM1-specific peptidase 2
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45975528-45996958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45995627 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 422 (T422A)
Ref Sequence ENSEMBL: ENSMUSP00000034051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034051] [ENSMUST00000053558] [ENSMUST00000066451] [ENSMUST00000110380] [ENSMUST00000130412] [ENSMUST00000153674] [ENSMUST00000209443] [ENSMUST00000210081]
PDB Structure
Ubiquitin-fold modifier 1 Specific Protease, UfSP2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034051
AA Change: T422A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034051
Gene: ENSMUSG00000031634
AA Change: T422A

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
Pfam:Peptidase_C78 268 453 1.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053558
SMART Domains Protein: ENSMUSP00000056828
Gene: ENSMUSG00000050914

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ANK 63 92 7.71e-2 SMART
ANK 96 125 7.29e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066451
SMART Domains Protein: ENSMUSP00000067177
Gene: ENSMUSG00000031637

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
SEL1 110 145 4.45e-3 SMART
SEL1 153 188 5.07e-7 SMART
SEL1 193 226 6.3e-3 SMART
SEL1 227 262 3.9e-8 SMART
Blast:SEL1 263 293 1e-5 BLAST
SEL1 317 352 7.57e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110380
SMART Domains Protein: ENSMUSP00000106009
Gene: ENSMUSG00000031637

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
SEL1 89 124 4.45e-3 SMART
SEL1 132 167 5.07e-7 SMART
SEL1 172 205 6.3e-3 SMART
SEL1 206 241 3.9e-8 SMART
Blast:SEL1 242 272 1e-5 BLAST
SEL1 296 331 7.57e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151983
Predicted Effect probably benign
Transcript: ENSMUST00000153674
Predicted Effect probably benign
Transcript: ENSMUST00000209443
Predicted Effect probably benign
Transcript: ENSMUST00000210081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210971
Meta Mutation Damage Score 0.1431 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cysteine protease. The protein cleaves two C-terminal residues from ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein. Activation of ubiquitin-fold modifier 1 by the encoded protein exposes a C-terminal glycine residue that allows interaction with other proteins and transfer to its target protein. An allelic variant of this gene has been associated with Beukes hip dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Ufsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Ufsp2 APN 8 45995664 critical splice donor site probably null
IGL02122:Ufsp2 APN 8 45995648 missense probably benign 0.01
IGL02523:Ufsp2 APN 8 45983548 missense probably damaging 1.00
IGL03031:Ufsp2 APN 8 45984100 missense probably damaging 1.00
R0317:Ufsp2 UTSW 8 45992233 critical splice donor site probably null
R0523:Ufsp2 UTSW 8 45996743 missense probably benign 0.00
R0538:Ufsp2 UTSW 8 45992150 missense probably damaging 1.00
R0661:Ufsp2 UTSW 8 45979233 start codon destroyed probably null 1.00
R3927:Ufsp2 UTSW 8 45983686 splice site probably null
R4355:Ufsp2 UTSW 8 45985465 missense possibly damaging 0.95
R5183:Ufsp2 UTSW 8 45994089 missense probably benign 0.18
R5473:Ufsp2 UTSW 8 45992221 missense probably damaging 1.00
R6726:Ufsp2 UTSW 8 45985467 missense probably benign 0.05
R7133:Ufsp2 UTSW 8 45983624 missense probably benign 0.00
R7534:Ufsp2 UTSW 8 45980324 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGGGCCTTTCTCAGTTGATTTAAAG -3'
(R):5'- AGGGCCAGGATTACTCAACAG -3'

Sequencing Primer
(F):5'- TGCTATCATGGTCTTTTACA -3'
(R):5'- GACTTAGAACAACTGCTGTCAGGTC -3'
Posted On2015-06-24