Incidental Mutation 'R4319:Olfr1392'
ID324137
Institutional Source Beutler Lab
Gene Symbol Olfr1392
Ensembl Gene ENSMUSG00000101750
Gene Nameolfactory receptor 1392
SynonymsMOR256-25, GA_x6K02T2QP88-6141322-6140387
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49285282-49295891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49293676 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 118 (M118I)
Ref Sequence ENSEMBL: ENSMUSP00000149746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189851] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
Predicted Effect probably damaging
Transcript: ENSMUST00000189851
AA Change: M118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140904
Gene: ENSMUSG00000101750
AA Change: M118I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 222 7.1e-8 PFAM
Pfam:7tm_1 41 289 2.4e-32 PFAM
Pfam:7tm_4 139 282 1.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213684
Predicted Effect probably damaging
Transcript: ENSMUST00000214170
AA Change: M118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214516
Predicted Effect probably damaging
Transcript: ENSMUST00000214598
AA Change: M118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215861
AA Change: M118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217275
AA Change: M118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1515 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Olfr1392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr1392 APN 11 49293630 missense possibly damaging 0.55
IGL02530:Olfr1392 APN 11 49293728 missense possibly damaging 0.78
IGL03026:Olfr1392 APN 11 49293458 missense probably damaging 0.99
IGL03106:Olfr1392 APN 11 49294161 missense probably damaging 0.99
R0357:Olfr1392 UTSW 11 49293786 missense probably damaging 0.96
R0396:Olfr1392 UTSW 11 49293338 missense probably benign 0.00
R2281:Olfr1392 UTSW 11 49293632 missense probably benign 0.04
R4320:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4322:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4323:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R5327:Olfr1392 UTSW 11 49293666 missense probably damaging 1.00
R6749:Olfr1392 UTSW 11 49294050 missense probably damaging 1.00
R7779:Olfr1392 UTSW 11 49294221 missense probably damaging 1.00
R8122:Olfr1392 UTSW 11 49293574 missense probably damaging 0.99
X0012:Olfr1392 UTSW 11 49293933 missense probably benign 0.36
X0025:Olfr1392 UTSW 11 49293953 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAATGGACCTTCAACTGCAC -3'
(R):5'- GAGGAAGACAGGCATCTCAC -3'

Sequencing Primer
(F):5'- GCACACCCCCATGTACTACTTC -3'
(R):5'- TCTCACAGAAGAAGTGATTCAGTCG -3'
Posted On2015-06-24