Incidental Mutation 'R4319:Ccdc191'
ID 324142
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R4319 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43947509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000116078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect probably damaging
Transcript: ENSMUST00000122440
AA Change: E267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: E267G

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: E624G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: E624G

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145999
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: E682G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: E682G

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R7843:Ccdc191 UTSW 16 43959336 missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43889899 start gained probably benign
R8984:Ccdc191 UTSW 16 43890218 intron probably benign
R8987:Ccdc191 UTSW 16 43931347 missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43898149 missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43905468 missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43943678 nonsense probably null
R9448:Ccdc191 UTSW 16 43938975 missense
R9507:Ccdc191 UTSW 16 43943829 missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43941807 missense
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TACTTTGCTGCCTCAGGACC -3'
(R):5'- GTAAGGTCCTATCTTTTCAACTAGC -3'

Sequencing Primer
(F):5'- TGCTGCCTCAGGACCAAAGAC -3'
(R):5'- GCATTTAATAACTTGCTTTCCCAG -3'
Posted On 2015-06-24