Incidental Mutation 'R4319:Luc7l'
ID324144
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene NameLuc7-like
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26252910-26285504 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 26277619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000152107] [ENSMUST00000154235]
Predicted Effect unknown
Transcript: ENSMUST00000025023
AA Change: E254V
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188
AA Change: E254V

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114976
AA Change: E254V
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188
AA Change: E254V

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119928
AA Change: E254V
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188
AA Change: E254V

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect unknown
Transcript: ENSMUST00000140427
AA Change: E168V
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188
AA Change: E168V

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect unknown
Transcript: ENSMUST00000152107
AA Change: E53V
SMART Domains Protein: ENSMUSP00000119717
Gene: ENSMUSG00000024188
AA Change: E53V

DomainStartEndE-ValueType
coiled coil region 8 55 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1114:Luc7l UTSW 17 26275858 splice site probably benign
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2112:Luc7l UTSW 17 26255127 critical splice donor site probably null
R2286:Luc7l UTSW 17 26280046 utr 3 prime probably benign
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4384:Luc7l UTSW 17 26279962 splice site probably benign
R5160:Luc7l UTSW 17 26267297 missense probably benign 0.27
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7418:Luc7l UTSW 17 26253182 unclassified probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
R8077:Luc7l UTSW 17 26255073 missense probably damaging 1.00
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Z1177:Luc7l UTSW 17 26281661 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAGTTCAGCCCCTTTTCTG -3'
(R):5'- GTTTTGCTTTTAAAGGCTACACTGG -3'

Sequencing Primer
(F):5'- TGTCACCAAATGTAGAAAATGATGG -3'
(R):5'- CCAGGTGTGATGGCATATACC -3'
Posted On2015-06-24