Incidental Mutation 'R4319:Lemd2'
ID324145
Institutional Source Beutler Lab
Gene Symbol Lemd2
Ensembl Gene ENSMUSG00000044857
Gene NameLEM domain containing 2
SynonymsNET25, Lem2
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27189601-27204438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27201677 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 254 (M254T)
Ref Sequence ENSEMBL: ENSMUSP00000058221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055117
AA Change: M254T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058221
Gene: ENSMUSG00000044857
AA Change: M254T

DomainStartEndE-ValueType
LEM 1 42 2.19e-16 SMART
low complexity region 65 86 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
transmembrane domain 221 239 N/A INTRINSIC
Pfam:MSC 251 503 7.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180434
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LEM domain-containing transmembrane protein of the inner nuclear membrane. The protein is involved in nuclear structure organization and plays a role in cell signaling and differentiation. Mutations in this gene result in Cataract 46, juvenile-onset. Multiple transcript variants have been found for this gene. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygotes for a gene-trapped allele die by E11.5 exhibiting reduced embryo size and cell density in neural tissue and mesenchyme, underdeveloped cardiac and neural tissue, and hyperactivation of MAPK and AKT signaling. Heterozygotes show a modest delayin cardiotoxin-induced muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Lemd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Lemd2 APN 17 27190728 missense probably damaging 1.00
IGL02161:Lemd2 APN 17 27190651 missense probably damaging 1.00
IGL02903:Lemd2 APN 17 27193210 splice site probably benign
R0078:Lemd2 UTSW 17 27203728 missense probably benign 0.17
R0458:Lemd2 UTSW 17 27190653 missense probably damaging 0.99
R1396:Lemd2 UTSW 17 27190732 missense probably damaging 1.00
R3106:Lemd2 UTSW 17 27201670 missense probably damaging 1.00
R4930:Lemd2 UTSW 17 27193832 splice site probably null
R5172:Lemd2 UTSW 17 27195382 nonsense probably null
R5239:Lemd2 UTSW 17 27203799 missense possibly damaging 0.53
R6005:Lemd2 UTSW 17 27190785 missense probably damaging 1.00
R6196:Lemd2 UTSW 17 27193002 nonsense probably null
R6621:Lemd2 UTSW 17 27195392 missense probably benign 0.01
R7208:Lemd2 UTSW 17 27196191 missense probably damaging 1.00
R7552:Lemd2 UTSW 17 27193836 critical splice donor site probably null
R7558:Lemd2 UTSW 17 27204163 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGAACATGATGTGATTCCGG -3'
(R):5'- GCTGGTTCATGTACAGCTGG -3'

Sequencing Primer
(F):5'- TGAGTCCTCAGGAAGACT -3'
(R):5'- TTCATGTACAGCTGGAAAGAGGCC -3'
Posted On2015-06-24