Incidental Mutation 'R4319:Srbd1'
ID 324148
Institutional Source Beutler Lab
Gene Symbol Srbd1
Ensembl Gene ENSMUSG00000024135
Gene Name S1 RNA binding domain 1
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock # R4319 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 85984665-86145175 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86051150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 657 (V657D)
Ref Sequence ENSEMBL: ENSMUSP00000092810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095187]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000095187
AA Change: V657D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: V657D

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Tex_N 213 403 2.8e-43 PFAM
YqgFc 532 631 4.1e-32 SMART
Pfam:HHH_7 668 764 1.6e-6 PFAM
Pfam:HHH_3 698 762 4.2e-25 PFAM
S1 903 978 7e-15 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Srbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Srbd1 APN 17 86115209 missense probably damaging 1.00
IGL00988:Srbd1 APN 17 86130270 missense probably damaging 0.96
IGL01111:Srbd1 APN 17 86098533 missense probably benign 0.15
IGL02186:Srbd1 APN 17 86109231 missense probably benign
IGL02233:Srbd1 APN 17 86098622 splice site probably null
IGL02307:Srbd1 APN 17 86126188 missense probably damaging 1.00
IGL02392:Srbd1 APN 17 85988373 missense probably benign 0.34
IGL02831:Srbd1 APN 17 86003871 missense probably damaging 1.00
IGL03299:Srbd1 APN 17 86120659 missense possibly damaging 0.95
PIT4494001:Srbd1 UTSW 17 86142359 critical splice donor site probably null
PIT4677001:Srbd1 UTSW 17 86115212 nonsense probably null
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0464:Srbd1 UTSW 17 86120002 missense probably damaging 1.00
R0692:Srbd1 UTSW 17 86136460 missense probably benign 0.25
R0771:Srbd1 UTSW 17 86130254 missense probably benign 0.09
R1074:Srbd1 UTSW 17 86003952 missense probably damaging 1.00
R1173:Srbd1 UTSW 17 86098512 missense probably null 1.00
R1446:Srbd1 UTSW 17 86139152 missense probably benign 0.44
R1587:Srbd1 UTSW 17 85985437 missense probably damaging 1.00
R1780:Srbd1 UTSW 17 86057685 missense probably damaging 1.00
R1865:Srbd1 UTSW 17 86115304 splice site probably benign
R1933:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R1934:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R2002:Srbd1 UTSW 17 86142400 missense probably benign
R2228:Srbd1 UTSW 17 85985223 missense probably damaging 1.00
R3160:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3439:Srbd1 UTSW 17 86057759 missense probably benign 0.01
R3611:Srbd1 UTSW 17 86102927 missense probably benign 0.03
R4255:Srbd1 UTSW 17 86102922 missense possibly damaging 0.80
R4300:Srbd1 UTSW 17 85985204 missense probably damaging 0.98
R4619:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4620:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4629:Srbd1 UTSW 17 86120672 missense probably damaging 0.99
R5379:Srbd1 UTSW 17 86001536 missense possibly damaging 0.88
R5469:Srbd1 UTSW 17 86119942 missense possibly damaging 0.77
R5587:Srbd1 UTSW 17 86127801 missense probably damaging 0.99
R5726:Srbd1 UTSW 17 86120729 missense possibly damaging 0.89
R6166:Srbd1 UTSW 17 86099268 missense probably damaging 1.00
R6237:Srbd1 UTSW 17 85985295 missense probably damaging 0.99
R6696:Srbd1 UTSW 17 86139191 missense possibly damaging 0.46
R6971:Srbd1 UTSW 17 86099290 missense possibly damaging 0.79
R6986:Srbd1 UTSW 17 85985222 missense probably damaging 1.00
R7018:Srbd1 UTSW 17 86136415 missense possibly damaging 0.93
R7082:Srbd1 UTSW 17 86057732 missense probably damaging 1.00
R7209:Srbd1 UTSW 17 86001520 missense probably damaging 1.00
R7340:Srbd1 UTSW 17 86136354 missense probably benign 0.02
R7417:Srbd1 UTSW 17 86136321 missense probably benign
R7467:Srbd1 UTSW 17 86099274 missense probably damaging 0.96
R7833:Srbd1 UTSW 17 85985454 missense possibly damaging 0.63
R8720:Srbd1 UTSW 17 86051143 missense probably damaging 1.00
R8839:Srbd1 UTSW 17 85988421 missense probably benign
R8899:Srbd1 UTSW 17 85985457 missense
R8905:Srbd1 UTSW 17 86001462 missense probably benign 0.00
R9051:Srbd1 UTSW 17 86120687 missense possibly damaging 0.70
R9402:Srbd1 UTSW 17 86099277 missense probably benign 0.26
R9701:Srbd1 UTSW 17 86126131 missense probably damaging 1.00
R9729:Srbd1 UTSW 17 86130122 missense probably benign
R9733:Srbd1 UTSW 17 86115283 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTTGAAACTGTATAGGCTTTG -3'
(R):5'- TCAGGCACTCCACTTATGCC -3'

Sequencing Primer
(F):5'- GGCTTTGAAAATGGAAATCTACATCC -3'
(R):5'- TCATGGCCACATAGTAAGTTCCAGG -3'
Posted On 2015-06-24