Mutagenetix > Incidental Mutation

Incidental Mutation 'R4319:Srbd1'

324148

Institutional Source

Beutler Lab

Gene Symbol

Srbd1

Ensembl Gene

ENSMUSG00000024135

Gene Name

S1 RNA binding domain 1

Synonyms

MMRRC Submission

041660-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R4319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85984665-86145175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86051150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 657 (V657D)

Ref Sequence

ENSEMBL: ENSMUSP00000092810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000095187
AA Change: V657D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: V657D

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	104	128	N/A	INTRINSIC
Pfam:Tex_N	213	403	2.8e-43	PFAM
YqgFc	532	631	4.1e-32	SMART
Pfam:HHH_7	668	764	1.6e-6	PFAM
Pfam:HHH_3	698	762	4.2e-25	PFAM
S1	903	978	7e-15	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (31/33)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn7l2	A	T	3: 108,205,832	D218E	probably damaging	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Cacna1c	A	C	6: 118,654,369	I1148S	probably damaging	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Ccdc191	A	G	16: 43,947,509	E624G	probably damaging	Het
Cep290	A	C	10: 100,539,047	H1385P	probably benign	Het
Chrd	A	G	16: 20,737,048	H545R	probably damaging	Het
Dgkb	A	G	12: 38,438,599	I655V	probably damaging	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Gm2663	G	T	6: 40,997,596	Q87K	probably damaging	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Kif11	T	C	19: 37,384,585	V84A	probably damaging	Het
Klf2	A	G	8: 72,320,161	T270A	probably benign	Het
Lemd2	A	G	17: 27,201,677	M254T	possibly damaging	Het
Luc7l	A	T	17: 26,277,619		probably benign	Het
Mapk11	T	C	15: 89,146,743	E71G	probably damaging	Het
Mcoln2	G	A	3: 146,150,011		probably null	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Pygb	G	T	2: 150,815,614		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Spty2d1	T	C	7: 46,998,135	S349G	probably damaging	Het
Tspo2	G	T	17: 48,449,843		probably benign	Het
Ufsp2	A	G	8: 45,995,627	T422A	possibly damaging	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Wdr46	A	G	17: 33,940,744	T3A	probably benign	Het

Other mutations in Srbd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Srbd1	APN	17	86115209	missense	probably damaging	1.00
IGL00988:Srbd1	APN	17	86130270	missense	probably damaging	0.96
IGL01111:Srbd1	APN	17	86098533	missense	probably benign	0.15
IGL02186:Srbd1	APN	17	86109231	missense	probably benign
IGL02233:Srbd1	APN	17	86098622	splice site	probably null
IGL02307:Srbd1	APN	17	86126188	missense	probably damaging	1.00
IGL02392:Srbd1	APN	17	85988373	missense	probably benign	0.34
IGL02831:Srbd1	APN	17	86003871	missense	probably damaging	1.00
IGL03299:Srbd1	APN	17	86120659	missense	possibly damaging	0.95
PIT4494001:Srbd1	UTSW	17	86142359	critical splice donor site	probably null
PIT4677001:Srbd1	UTSW	17	86115212	nonsense	probably null
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0464:Srbd1	UTSW	17	86120002	missense	probably damaging	1.00
R0692:Srbd1	UTSW	17	86136460	missense	probably benign	0.25
R0771:Srbd1	UTSW	17	86130254	missense	probably benign	0.09
R1074:Srbd1	UTSW	17	86003952	missense	probably damaging	1.00
R1173:Srbd1	UTSW	17	86098512	missense	probably null	1.00
R1446:Srbd1	UTSW	17	86139152	missense	probably benign	0.44
R1587:Srbd1	UTSW	17	85985437	missense	probably damaging	1.00
R1780:Srbd1	UTSW	17	86057685	missense	probably damaging	1.00
R1865:Srbd1	UTSW	17	86115304	splice site	probably benign
R1933:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R1934:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R2002:Srbd1	UTSW	17	86142400	missense	probably benign
R2228:Srbd1	UTSW	17	85985223	missense	probably damaging	1.00
R3160:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3439:Srbd1	UTSW	17	86057759	missense	probably benign	0.01
R3611:Srbd1	UTSW	17	86102927	missense	probably benign	0.03
R4255:Srbd1	UTSW	17	86102922	missense	possibly damaging	0.80
R4300:Srbd1	UTSW	17	85985204	missense	probably damaging	0.98
R4619:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4620:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4629:Srbd1	UTSW	17	86120672	missense	probably damaging	0.99
R5379:Srbd1	UTSW	17	86001536	missense	possibly damaging	0.88
R5469:Srbd1	UTSW	17	86119942	missense	possibly damaging	0.77
R5587:Srbd1	UTSW	17	86127801	missense	probably damaging	0.99
R5726:Srbd1	UTSW	17	86120729	missense	possibly damaging	0.89
R6166:Srbd1	UTSW	17	86099268	missense	probably damaging	1.00
R6237:Srbd1	UTSW	17	85985295	missense	probably damaging	0.99
R6696:Srbd1	UTSW	17	86139191	missense	possibly damaging	0.46
R6971:Srbd1	UTSW	17	86099290	missense	possibly damaging	0.79
R6986:Srbd1	UTSW	17	85985222	missense	probably damaging	1.00
R7018:Srbd1	UTSW	17	86136415	missense	possibly damaging	0.93
R7082:Srbd1	UTSW	17	86057732	missense	probably damaging	1.00
R7209:Srbd1	UTSW	17	86001520	missense	probably damaging	1.00
R7340:Srbd1	UTSW	17	86136354	missense	probably benign	0.02
R7417:Srbd1	UTSW	17	86136321	missense	probably benign
R7467:Srbd1	UTSW	17	86099274	missense	probably damaging	0.96
R7833:Srbd1	UTSW	17	85985454	missense	possibly damaging	0.63
R8720:Srbd1	UTSW	17	86051143	missense	probably damaging	1.00
R8839:Srbd1	UTSW	17	85988421	missense	probably benign
R8899:Srbd1	UTSW	17	85985457	missense
R8905:Srbd1	UTSW	17	86001462	missense	probably benign	0.00
R9051:Srbd1	UTSW	17	86120687	missense	possibly damaging	0.70
R9402:Srbd1	UTSW	17	86099277	missense	probably benign	0.26
R9701:Srbd1	UTSW	17	86126131	missense	probably damaging	1.00
R9729:Srbd1	UTSW	17	86130122	missense	probably benign
R9733:Srbd1	UTSW	17	86115283	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGCTTGAAACTGTATAGGCTTTG -3'
(R):5'- TCAGGCACTCCACTTATGCC -3'

Sequencing Primer
(F):5'- GGCTTTGAAAATGGAAATCTACATCC -3'
(R):5'- TCATGGCCACATAGTAAGTTCCAGG -3'

Posted On

2015-06-24