Incidental Mutation 'R4319:Kif11'
ID324149
Institutional Source Beutler Lab
Gene Symbol Kif11
Ensembl Gene ENSMUSG00000012443
Gene Namekinesin family member 11
SynonymsEg5, Knsl1, Kifl1
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37376403-37421859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37384585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 84 (V84A)
Ref Sequence ENSEMBL: ENSMUSP00000012587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012587]
Predicted Effect probably damaging
Transcript: ENSMUST00000012587
AA Change: V84A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000012587
Gene: ENSMUSG00000012443
AA Change: V84A

DomainStartEndE-ValueType
KISc 15 366 8.21e-180 SMART
Blast:KISc 372 417 1e-16 BLAST
low complexity region 453 465 N/A INTRINSIC
Pfam:Microtub_bind 915 1049 1.2e-44 PFAM
Meta Mutation Damage Score 0.3698 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of Kif11 results in early embryonic lethality of homozygotes, with developmental growth arrest at E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Kif11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Kif11 APN 19 37411409 missense possibly damaging 0.82
IGL00785:Kif11 APN 19 37404297 missense probably benign 0.01
IGL00785:Kif11 APN 19 37404298 missense probably damaging 0.99
IGL01586:Kif11 APN 19 37384233 splice site probably benign
IGL01883:Kif11 APN 19 37384343 missense probably benign 0.01
IGL02138:Kif11 APN 19 37384609 missense probably damaging 1.00
IGL03197:Kif11 APN 19 37407027 missense probably benign 0.00
PIT4151001:Kif11 UTSW 19 37384597 missense probably damaging 1.00
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0104:Kif11 UTSW 19 37413215 missense probably benign 0.00
R0254:Kif11 UTSW 19 37411509 missense probably benign 0.00
R0631:Kif11 UTSW 19 37413117 splice site probably benign
R1607:Kif11 UTSW 19 37387200 nonsense probably null
R1895:Kif11 UTSW 19 37387399 missense probably damaging 1.00
R1983:Kif11 UTSW 19 37390776 missense possibly damaging 0.78
R2056:Kif11 UTSW 19 37402212 missense probably benign 0.17
R2158:Kif11 UTSW 19 37410614 missense probably benign
R2291:Kif11 UTSW 19 37407003 missense probably benign
R2300:Kif11 UTSW 19 37411539 missense probably benign 0.01
R2850:Kif11 UTSW 19 37409493 missense probably benign
R2904:Kif11 UTSW 19 37403655 splice site probably benign
R3035:Kif11 UTSW 19 37407053 missense possibly damaging 0.92
R3908:Kif11 UTSW 19 37390721 missense probably damaging 1.00
R4356:Kif11 UTSW 19 37411435 missense probably benign 0.00
R4469:Kif11 UTSW 19 37416492 missense probably benign 0.05
R4623:Kif11 UTSW 19 37409747 missense probably benign
R4779:Kif11 UTSW 19 37417949 missense probably benign 0.00
R4911:Kif11 UTSW 19 37417937 missense probably benign 0.00
R4980:Kif11 UTSW 19 37387371 nonsense probably null
R5109:Kif11 UTSW 19 37384615 missense possibly damaging 0.81
R5770:Kif11 UTSW 19 37390865 missense probably benign 0.03
R6023:Kif11 UTSW 19 37390710 missense probably damaging 1.00
R6666:Kif11 UTSW 19 37409766 missense probably benign
R6755:Kif11 UTSW 19 37409751 missense probably benign 0.01
R6845:Kif11 UTSW 19 37404117 missense probably damaging 1.00
R7052:Kif11 UTSW 19 37384592 nonsense probably null
R7367:Kif11 UTSW 19 37420341 missense probably benign
R7387:Kif11 UTSW 19 37409756 missense probably damaging 1.00
R7485:Kif11 UTSW 19 37410624 missense possibly damaging 0.94
R7502:Kif11 UTSW 19 37409807 missense possibly damaging 0.53
R7591:Kif11 UTSW 19 37384263 missense probably damaging 1.00
R7618:Kif11 UTSW 19 37411560 missense probably benign 0.32
R7809:Kif11 UTSW 19 37384609 missense probably damaging 1.00
R8181:Kif11 UTSW 19 37390647 critical splice acceptor site probably null
R8274:Kif11 UTSW 19 37403546 missense probably damaging 0.99
Z1177:Kif11 UTSW 19 37413287 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTGACGGACAAGACCTCCAAG -3'
(R):5'- TTTCCAGTGCCAGTCTGAC -3'

Sequencing Primer
(F):5'- ATACACGTTTGATATGGTACTGATGG -3'
(R):5'- TTACGCGAAGATGGTGC -3'
Posted On2015-06-24