Incidental Mutation 'R0004:Colec10'
ID32415
Institutional Source Beutler Lab
Gene Symbol Colec10
Ensembl Gene ENSMUSG00000038591
Gene Namecollectin sub-family member 10
SynonymsCL-L1
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location54410774-54466358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54410875 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 33 (R33L)
Ref Sequence ENSEMBL: ENSMUSP00000037867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036737
AA Change: R33L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037867
Gene: ENSMUSG00000038591
AA Change: R33L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Collagen 44 96 1.4e-9 PFAM
Pfam:Collagen 65 123 4.3e-10 PFAM
CLECT 148 271 1.09e-16 SMART
Meta Mutation Damage Score 0.1330 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Colec10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Colec10 APN 15 54459761 missense probably damaging 0.98
BB002:Colec10 UTSW 15 54462371 missense probably damaging 0.97
BB012:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R0060:Colec10 UTSW 15 54439146 splice site probably benign
R0060:Colec10 UTSW 15 54439146 splice site probably benign
R0827:Colec10 UTSW 15 54462584 missense probably damaging 1.00
R1238:Colec10 UTSW 15 54462439 missense possibly damaging 0.75
R1551:Colec10 UTSW 15 54462262 missense probably damaging 1.00
R2371:Colec10 UTSW 15 54462400 missense possibly damaging 0.84
R4023:Colec10 UTSW 15 54462551 missense probably damaging 1.00
R4024:Colec10 UTSW 15 54462551 missense probably damaging 1.00
R4628:Colec10 UTSW 15 54459731 missense possibly damaging 0.68
R5893:Colec10 UTSW 15 54410789 missense probably benign 0.18
R6062:Colec10 UTSW 15 54459807 missense possibly damaging 0.93
R6489:Colec10 UTSW 15 54462213 splice site probably null
R6775:Colec10 UTSW 15 54435023 missense possibly damaging 0.95
R6928:Colec10 UTSW 15 54462606 missense probably damaging 1.00
R7124:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R7925:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R8208:Colec10 UTSW 15 54462300 missense possibly damaging 0.62
R8363:Colec10 UTSW 15 54410842 missense probably benign
RF003:Colec10 UTSW 15 54462391 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCTTATGGAGAGGTTTGCACTGAC -3'
(R):5'- CCATCTAAACGCACTGGAAGAGGG -3'

Sequencing Primer
(F):5'- GAGGTTTGCACTGACCTGAATATC -3'
(R):5'- GGGTCCTCAGTGTTCGACATC -3'
Posted On2013-05-09