Incidental Mutation 'R4342:Parp1'
ID 324152
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Name poly (ADP-ribose) polymerase family, member 1
Synonyms Adprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 180568924-180601254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 180587329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 411 (A411S)
Ref Sequence ENSEMBL: ENSMUSP00000027777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027777
AA Change: A411S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: A411S

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192411
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 splice site probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 splice site probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
R8735:Parp1 UTSW 1 180569125 missense probably benign 0.04
R8747:Parp1 UTSW 1 180594710 missense probably damaging 1.00
R8782:Parp1 UTSW 1 180589562 missense probably benign 0.01
R9243:Parp1 UTSW 1 180588115 missense probably benign 0.30
R9268:Parp1 UTSW 1 180587944 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTTTCTCCTAAAGCCAGCTG -3'
(R):5'- TACAGAGGACCCAGGATACC -3'

Sequencing Primer
(F):5'- AAAGCCAGCTGTTTTGTCTTGC -3'
(R):5'- TGTAAGCTTACGGGACTGAGCC -3'
Posted On 2015-06-24