Incidental Mutation 'R4342:Gm996'
ID 324153
Institutional Source Beutler Lab
Gene Symbol Gm996
Ensembl Gene ENSMUSG00000029419
Gene Name predicted gene 996
Synonyms LOC381353
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25575416-25581757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25579108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 264 (Y264H)
Ref Sequence ENSEMBL: ENSMUSP00000140109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
AlphaFold A2AJA9
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114217
AA Change: Y264H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: Y264H

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect possibly damaging
Transcript: ENSMUST00000188161
AA Change: Y264H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: Y264H

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191602
AA Change: Y264H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: Y264H

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Meta Mutation Damage Score 0.1167 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Gm996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gm996 APN 2 25579407 missense probably damaging 0.97
IGL01370:Gm996 APN 2 25578957 missense possibly damaging 0.82
IGL01973:Gm996 APN 2 25579572 nonsense probably null
IGL01987:Gm996 APN 2 25577958 missense possibly damaging 0.82
IGL02534:Gm996 APN 2 25577031 nonsense probably null
R0457:Gm996 UTSW 2 25578346 missense possibly damaging 0.66
R0799:Gm996 UTSW 2 25578562 missense possibly damaging 0.83
R0931:Gm996 UTSW 2 25578489 missense possibly damaging 0.82
R1243:Gm996 UTSW 2 25578558 missense possibly damaging 0.66
R1477:Gm996 UTSW 2 25579753 missense possibly damaging 0.66
R1559:Gm996 UTSW 2 25577031 nonsense probably null
R1661:Gm996 UTSW 2 25579155 missense possibly damaging 0.90
R1796:Gm996 UTSW 2 25577988 missense probably damaging 1.00
R3955:Gm996 UTSW 2 25577571 nonsense probably null
R4005:Gm996 UTSW 2 25578856 missense probably benign 0.01
R4579:Gm996 UTSW 2 25579649 missense possibly damaging 0.66
R4621:Gm996 UTSW 2 25578400 missense probably damaging 0.96
R4770:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4834:Gm996 UTSW 2 25579518 missense possibly damaging 0.82
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4887:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4888:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R5472:Gm996 UTSW 2 25579702 missense probably benign
R5632:Gm996 UTSW 2 25579264 missense probably benign
R6816:Gm996 UTSW 2 25579721 frame shift probably null
R6818:Gm996 UTSW 2 25579721 frame shift probably null
R6861:Gm996 UTSW 2 25579721 frame shift probably null
R7164:Gm996 UTSW 2 25578567 missense possibly damaging 0.66
R7543:Gm996 UTSW 2 25577398 missense possibly damaging 0.81
R7748:Gm996 UTSW 2 25578959 missense possibly damaging 0.46
R7783:Gm996 UTSW 2 25577808 missense probably damaging 0.97
R7826:Gm996 UTSW 2 25578465 missense possibly damaging 0.66
R8117:Gm996 UTSW 2 25579234 missense probably benign 0.27
R8694:Gm996 UTSW 2 25579819 missense possibly damaging 0.83
R8708:Gm996 UTSW 2 25577802 missense possibly damaging 0.66
R8830:Gm996 UTSW 2 25577250 missense
R8904:Gm996 UTSW 2 25577902 missense probably benign 0.27
R8928:Gm996 UTSW 2 25578565 missense possibly damaging 0.92
R9253:Gm996 UTSW 2 25577160 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTACTTCGCCAGCATAGTAGC -3'
(R):5'- TTTGGACATCAAGCCGGAC -3'

Sequencing Primer
(F):5'- ATAGTAGCTGCCCCCACG -3'
(R):5'- CGAAGCTCGCGATCTTGC -3'
Posted On 2015-06-24