Incidental Mutation 'R4342:Ralgds'
ID 324154
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Name ral guanine nucleotide dissociation stimulator
Synonyms RalGDS, Gnds, Rgds
MMRRC Submission 041100-MU
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 28513125-28553081 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28552095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 96 (L96P)
Ref Sequence ENSEMBL: ENSMUSP00000118966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028161] [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000140704]
AlphaFold Q03385
Predicted Effect probably benign
Transcript: ENSMUST00000028161
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028170
AA Change: L796P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: L796P

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100241
AA Change: L851P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: L851P

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113893
AA Change: L839P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: L839P

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably damaging
Transcript: ENSMUST00000140704
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821
AA Change: L96P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7399:Ralgds UTSW 2 28543655 missense possibly damaging 0.95
R7446:Ralgds UTSW 2 28545889 missense probably damaging 0.99
R7560:Ralgds UTSW 2 28547595 missense probably damaging 1.00
R8384:Ralgds UTSW 2 28547170 missense probably damaging 1.00
R9422:Ralgds UTSW 2 28545172 missense probably benign
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGAGACTTCCTTAGGC -3'
(R):5'- TCTGTAAGTGCTTAGTCTCCAGC -3'

Sequencing Primer
(F):5'- TAGGCTCTCATTGACCTCTACTGGG -3'
(R):5'- GAGACGTCCTTAGAAGATGCCTTTG -3'
Posted On 2015-06-24