Incidental Mutation 'R0004:Washc5'
ID32416
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene NameWASH complex subunit 5
SynonymsE430025E21Rik, strumpellin
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location59331997-59374167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59367467 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 149 (M149T)
Ref Sequence ENSEMBL: ENSMUSP00000022976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976]
Predicted Effect probably damaging
Transcript: ENSMUST00000022976
AA Change: M149T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: M149T

DomainStartEndE-ValueType
Pfam:Strumpellin 23 1103 N/A PFAM
Meta Mutation Damage Score 0.7128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59337276 missense probably damaging 0.99
IGL01096:Washc5 APN 15 59350211 splice site probably benign
IGL01305:Washc5 APN 15 59355839 nonsense probably null
IGL01707:Washc5 APN 15 59342015 missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59342109 splice site probably null
IGL02056:Washc5 APN 15 59350336 missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59369211 missense probably benign
IGL02430:Washc5 APN 15 59366291 missense probably damaging 1.00
IGL02450:Washc5 APN 15 59332317 nonsense probably null
IGL03238:Washc5 APN 15 59346842 missense probably damaging 1.00
IGL03351:Washc5 APN 15 59363350 splice site probably benign
ANU22:Washc5 UTSW 15 59355839 nonsense probably null
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59352530 missense probably benign 0.01
R0265:Washc5 UTSW 15 59338960 missense probably benign 0.43
R0315:Washc5 UTSW 15 59341976 missense probably damaging 1.00
R0545:Washc5 UTSW 15 59342093 missense possibly damaging 0.50
R0611:Washc5 UTSW 15 59341158 missense probably damaging 0.99
R0636:Washc5 UTSW 15 59359409 missense probably benign 0.01
R1006:Washc5 UTSW 15 59369186 missense probably benign 0.21
R1006:Washc5 UTSW 15 59369187 missense probably benign 0.06
R1237:Washc5 UTSW 15 59338908 splice site probably benign
R1835:Washc5 UTSW 15 59359340 missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R2005:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59350408 missense probably damaging 1.00
R2134:Washc5 UTSW 15 59369234 missense probably damaging 1.00
R2139:Washc5 UTSW 15 59350142 missense probably damaging 1.00
R2177:Washc5 UTSW 15 59363269 nonsense probably null
R2975:Washc5 UTSW 15 59345358 missense probably damaging 1.00
R4088:Washc5 UTSW 15 59339862 missense probably damaging 1.00
R4824:Washc5 UTSW 15 59333636 nonsense probably null
R4843:Washc5 UTSW 15 59350371 missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59344080 missense probably damaging 1.00
R4996:Washc5 UTSW 15 59333635 missense probably benign
R5103:Washc5 UTSW 15 59350169 missense probably damaging 1.00
R5312:Washc5 UTSW 15 59345528 splice site probably null
R5591:Washc5 UTSW 15 59369163 missense probably damaging 1.00
R6073:Washc5 UTSW 15 59335170 missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59335110 missense probably damaging 1.00
R6156:Washc5 UTSW 15 59345399 missense probably damaging 1.00
R6292:Washc5 UTSW 15 59355934 missense probably damaging 1.00
R6297:Washc5 UTSW 15 59344046 missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59337195 missense probably benign 0.14
R6659:Washc5 UTSW 15 59340890 critical splice donor site probably null
R6880:Washc5 UTSW 15 59350172 missense probably benign 0.00
R7146:Washc5 UTSW 15 59352501 nonsense probably null
R7330:Washc5 UTSW 15 59333667 missense probably benign 0.02
R7430:Washc5 UTSW 15 59369913 nonsense probably null
R7490:Washc5 UTSW 15 59337204 missense probably benign 0.18
R7532:Washc5 UTSW 15 59367411 missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59366192 missense probably damaging 0.97
R7803:Washc5 UTSW 15 59368459 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCACGTCAGGATGACAACAGAAAG -3'
(R):5'- CCGATCTGCACAGTCGTTAAGAGC -3'

Sequencing Primer
(F):5'- GGTATGGTAACTGCATCACCATC -3'
(R):5'- GGCCAGAGTGGTCATTTGTA -3'
Posted On2013-05-09