Mutagenetix > Incidental Mutations

Incidental Mutation 'R0004:Washc5'

32416

Institutional Source

Beutler Lab

Gene Symbol

Washc5

Ensembl Gene

ENSMUSG00000022350

Gene Name

WASH complex subunit 5

Synonyms

E430025E21Rik, strumpellin

MMRRC Submission

038300-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0004 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

59331997-59374167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59367467 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 149 (M149T)

Ref Sequence

ENSEMBL: ENSMUSP00000022976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022976]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022976
AA Change: M149T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: M149T

Domain	Start	End	E-Value	Type
Pfam:Strumpellin	23	1103	N/A	PFAM

Meta Mutation Damage Score

0.7128

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adal	T	C	2: 121,152,485	I86T	probably damaging	Het
Aff3	T	C	1: 38,269,726	D376G	possibly damaging	Het
Akap11	A	T	14: 78,514,940	H164Q	possibly damaging	Het
Akap12	A	T	10: 4,353,220	D10V	probably damaging	Het
Arhgap32	T	C	9: 32,151,998	V101A	probably damaging	Het
Atm	A	T	9: 53,453,528		probably benign	Het
Ccdc18	A	G	5: 108,161,700	D387G	possibly damaging	Het
Ccdc38	A	T	10: 93,574,102	Q261L	probably damaging	Het
Cd180	T	G	13: 102,702,708	V33G	probably benign	Het
Cd207	G	A	6: 83,674,248	Q242*	probably null	Het
Cnp	T	C	11: 100,576,807	F192S	probably damaging	Het
Colec10	G	T	15: 54,410,875	R33L	possibly damaging	Het
Csn1s1	A	T	5: 87,671,531	M16L	probably benign	Het
Dnah10	A	T	5: 124,726,902	M98L	probably benign	Het
Dnah17	T	C	11: 118,060,092	I2902V	possibly damaging	Het
Dtnb	A	G	12: 3,596,635		probably benign	Het
Epha5	T	C	5: 84,331,842	Y101C	probably damaging	Het
Ephb2	T	A	4: 136,657,524	M860L	probably damaging	Het
Fbxw18	T	C	9: 109,701,313	T77A	probably damaging	Het
Fgfbp3	A	G	19: 36,918,682	S179P	possibly damaging	Het
Foxp2	A	G	6: 15,197,096	T45A	possibly damaging	Het
Gckr	A	T	5: 31,297,589		probably benign	Het
Glce	T	A	9: 62,068,579	Q213L	probably damaging	Het
Gm1965	A	C	6: 89,146,487	H84P	unknown	Het
Hbegf	A	G	18: 36,507,506	V166A	probably damaging	Het
Helb	G	T	10: 120,108,981	H217N	probably damaging	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Kansl2	A	G	15: 98,520,376	L392P	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Klra3	A	G	6: 130,323,687	S240P	probably damaging	Het
Liph	T	A	16: 21,984,194	R42*	probably null	Het
Lrp1	A	T	10: 127,541,825		probably null	Het
Luc7l2	A	T	6: 38,589,234	K52M	probably damaging	Het
Mecom	G	A	3: 29,979,911	P215S	probably damaging	Het
Myo1g	T	A	11: 6,515,901	T395S	probably damaging	Het
Ndst4	T	A	3: 125,570,826	M384K	probably benign	Het
Ndufb2	C	T	6: 39,596,504	T51I	possibly damaging	Het
Nell1	C	A	7: 50,560,759		probably benign	Het
Olfr639	A	T	7: 104,012,431	N90K	probably benign	Het
Oxr1	G	A	15: 41,820,540	S434N	possibly damaging	Het
Pcdhac2	T	A	18: 37,145,237	S423R	probably benign	Het
Pcdhb10	T	A	18: 37,411,959	D29E	probably benign	Het
Pde10a	A	G	17: 8,981,576	T1053A	probably benign	Het
Pkdrej	T	A	15: 85,818,183	H1184L	probably damaging	Het
Prkaa2	C	T	4: 105,047,091	R263Q	probably null	Het
Prmt9	A	G	8: 77,555,782	I103V	possibly damaging	Het
Rbm15b	T	C	9: 106,884,936	T678A	probably benign	Het
Ryr2	T	C	13: 11,665,919	Y3180C	probably benign	Het
Scaf1	T	C	7: 45,007,670		probably benign	Het
Scn7a	T	A	2: 66,687,795	N1024I	possibly damaging	Het
Sec23b	T	C	2: 144,564,562		probably benign	Het
Sf1	C	A	19: 6,374,191	P417Q	probably damaging	Het
Slc4a3	A	T	1: 75,557,009		probably benign	Het
Stk32a	T	C	18: 43,305,056	W207R	probably damaging	Het
Syne1	A	T	10: 5,443,132		probably benign	Het
Tecta	A	T	9: 42,345,478	V1634E	possibly damaging	Het
Tenm2	A	G	11: 36,023,357	F2450S	probably damaging	Het
Tgfb1	T	C	7: 25,692,366		probably benign	Het
Tpgs2	A	G	18: 25,158,238		probably benign	Het
Wrn	A	T	8: 33,317,560	V290D	probably damaging	Het
Zbtb41	A	G	1: 139,442,888	T688A	possibly damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp791	G	A	8: 85,110,866	A123V	probably benign	Het

Other mutations in Washc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Washc5	APN	15	59337276	missense	probably damaging	0.99
IGL01096:Washc5	APN	15	59350211	splice site	probably benign
IGL01305:Washc5	APN	15	59355839	nonsense	probably null
IGL01707:Washc5	APN	15	59342015	missense	possibly damaging	0.89
IGL01921:Washc5	APN	15	59342109	splice site	probably null
IGL02056:Washc5	APN	15	59350336	missense	possibly damaging	0.63
IGL02145:Washc5	APN	15	59369211	missense	probably benign
IGL02430:Washc5	APN	15	59366291	missense	probably damaging	1.00
IGL02450:Washc5	APN	15	59332317	nonsense	probably null
IGL03238:Washc5	APN	15	59346842	missense	probably damaging	1.00
IGL03351:Washc5	APN	15	59363350	splice site	probably benign
ANU22:Washc5	UTSW	15	59355839	nonsense	probably null
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0179:Washc5	UTSW	15	59352530	missense	probably benign	0.01
R0265:Washc5	UTSW	15	59338960	missense	probably benign	0.43
R0315:Washc5	UTSW	15	59341976	missense	probably damaging	1.00
R0545:Washc5	UTSW	15	59342093	missense	possibly damaging	0.50
R0611:Washc5	UTSW	15	59341158	missense	probably damaging	0.99
R0636:Washc5	UTSW	15	59359409	missense	probably benign	0.01
R1006:Washc5	UTSW	15	59369186	missense	probably benign	0.21
R1006:Washc5	UTSW	15	59369187	missense	probably benign	0.06
R1237:Washc5	UTSW	15	59338908	splice site	probably benign
R1835:Washc5	UTSW	15	59359340	missense	possibly damaging	0.86
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R2005:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2006:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2060:Washc5	UTSW	15	59350408	missense	probably damaging	1.00
R2134:Washc5	UTSW	15	59369234	missense	probably damaging	1.00
R2139:Washc5	UTSW	15	59350142	missense	probably damaging	1.00
R2177:Washc5	UTSW	15	59363269	nonsense	probably null
R2975:Washc5	UTSW	15	59345358	missense	probably damaging	1.00
R4088:Washc5	UTSW	15	59339862	missense	probably damaging	1.00
R4824:Washc5	UTSW	15	59333636	nonsense	probably null
R4843:Washc5	UTSW	15	59350371	missense	possibly damaging	0.95
R4991:Washc5	UTSW	15	59344080	missense	probably damaging	1.00
R4996:Washc5	UTSW	15	59333635	missense	probably benign
R5103:Washc5	UTSW	15	59350169	missense	probably damaging	1.00
R5312:Washc5	UTSW	15	59345528	splice site	probably null
R5591:Washc5	UTSW	15	59369163	missense	probably damaging	1.00
R6073:Washc5	UTSW	15	59335170	missense	possibly damaging	0.90
R6123:Washc5	UTSW	15	59335110	missense	probably damaging	1.00
R6156:Washc5	UTSW	15	59345399	missense	probably damaging	1.00
R6292:Washc5	UTSW	15	59355934	missense	probably damaging	1.00
R6297:Washc5	UTSW	15	59344046	missense	possibly damaging	0.61
R6374:Washc5	UTSW	15	59337195	missense	probably benign	0.14
R6659:Washc5	UTSW	15	59340890	critical splice donor site	probably null
R6880:Washc5	UTSW	15	59350172	missense	probably benign	0.00
R7146:Washc5	UTSW	15	59352501	nonsense	probably null
R7330:Washc5	UTSW	15	59333667	missense	probably benign	0.02
R7430:Washc5	UTSW	15	59369913	nonsense	probably null
R7490:Washc5	UTSW	15	59337204	missense	probably benign	0.18
R7532:Washc5	UTSW	15	59367411	missense	possibly damaging	0.46
R7560:Washc5	UTSW	15	59366192	missense	probably damaging	0.97
R7803:Washc5	UTSW	15	59368459	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCACGTCAGGATGACAACAGAAAG -3'
(R):5'- CCGATCTGCACAGTCGTTAAGAGC -3'

Sequencing Primer
(F):5'- GGTATGGTAACTGCATCACCATC -3'
(R):5'- GGCCAGAGTGGTCATTTGTA -3'

Posted On

2013-05-09