Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Fhdc1'

324161

Institutional Source

Beutler Lab

Gene Symbol

Fhdc1

Ensembl Gene

ENSMUSG00000041842

Gene Name

FH2 domain containing 1

Synonyms

6330505N24Rik

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.431) question?

Stock #

R4342 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

84442198-84480429 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 84444826 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1031 (V1031F)

Ref Sequence

ENSEMBL: ENSMUSP00000103317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]

AlphaFold

Q3ULZ2

Predicted Effect

probably benign
Transcript: ENSMUST00000091002
AA Change: V1031F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: V1031F

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	55	82	N/A	INTRINSIC
FH2	88	538	5.13e-57	SMART
Blast:FH2	539	571	6e-6	BLAST
low complexity region	789	822	N/A	INTRINSIC
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1009	1026	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107689
AA Change: V1031F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: V1031F

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	55	82	N/A	INTRINSIC
FH2	88	538	5.13e-57	SMART
Blast:FH2	539	571	6e-6	BLAST
low complexity region	789	822	N/A	INTRINSIC
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1009	1026	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125643

Predicted Effect

probably benign
Transcript: ENSMUST00000194027

SMART Domains

Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842

Domain	Start	End	E-Value	Type
Pfam:FH2	1	145	3.8e-22	PFAM

Meta Mutation Damage Score

0.0644

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Fhdc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Fhdc1	APN	3	84448800	missense	probably damaging	1.00
IGL00556:Fhdc1	APN	3	84457242	missense	possibly damaging	0.81
IGL00951:Fhdc1	APN	3	84464313	missense	possibly damaging	0.90
IGL01744:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01754:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01762:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01764:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01769:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01778:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01779:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL01781:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02243:Fhdc1	APN	3	84474640	start codon destroyed	possibly damaging	0.89
IGL02260:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02261:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02266:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02271:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02284:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02292:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02296:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02301:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02347:Fhdc1	APN	3	84444735	missense	possibly damaging	0.66
IGL02416:Fhdc1	APN	3	84445228	missense	probably benign	0.03
IGL03189:Fhdc1	APN	3	84455061	intron	probably benign
IGL03392:Fhdc1	APN	3	84444519	missense	possibly damaging	0.55
R0125:Fhdc1	UTSW	3	84445545	missense	probably benign
R0135:Fhdc1	UTSW	3	84445618	missense	probably damaging	0.97
R0255:Fhdc1	UTSW	3	84453510	intron	probably benign
R0401:Fhdc1	UTSW	3	84444624	missense	probably benign	0.02
R1371:Fhdc1	UTSW	3	84445003	missense	probably damaging	1.00
R1727:Fhdc1	UTSW	3	84446176	missense	possibly damaging	0.50
R1769:Fhdc1	UTSW	3	84448778	missense	probably damaging	1.00
R1781:Fhdc1	UTSW	3	84448804	missense	probably damaging	0.99
R1840:Fhdc1	UTSW	3	84445821	missense	possibly damaging	0.46
R1970:Fhdc1	UTSW	3	84454851	missense	probably damaging	1.00
R2038:Fhdc1	UTSW	3	84444561	missense	probably benign	0.22
R2088:Fhdc1	UTSW	3	84474726	start gained	probably benign
R2256:Fhdc1	UTSW	3	84446046	missense	probably benign
R2939:Fhdc1	UTSW	3	84457270	missense	possibly damaging	0.47
R3813:Fhdc1	UTSW	3	84464270	critical splice donor site	probably null
R4022:Fhdc1	UTSW	3	84445102	missense	probably benign	0.01
R4175:Fhdc1	UTSW	3	84456987	intron	probably benign
R4243:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4245:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4290:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4291:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4292:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4293:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4294:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4295:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4334:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4335:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4344:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4354:Fhdc1	UTSW	3	84444826	missense	probably benign	0.42
R4550:Fhdc1	UTSW	3	84445176	missense	probably benign	0.16
R4626:Fhdc1	UTSW	3	84474250	missense	probably damaging	1.00
R4925:Fhdc1	UTSW	3	84453533	missense	probably damaging	1.00
R5155:Fhdc1	UTSW	3	84446150	missense	probably benign	0.00
R5588:Fhdc1	UTSW	3	84465476	missense	possibly damaging	0.91
R6043:Fhdc1	UTSW	3	84448886	missense	probably damaging	0.96
R6063:Fhdc1	UTSW	3	84446029	missense	probably benign	0.00
R6652:Fhdc1	UTSW	3	84464324	missense	probably damaging	1.00
R6706:Fhdc1	UTSW	3	84446422	missense	probably damaging	1.00
R6783:Fhdc1	UTSW	3	84445527	missense	probably benign	0.00
R6984:Fhdc1	UTSW	3	84444516	missense	possibly damaging	0.93
R7182:Fhdc1	UTSW	3	84448850	missense	probably damaging	0.98
R7299:Fhdc1	UTSW	3	84444540	missense	probably damaging	1.00
R7574:Fhdc1	UTSW	3	84446131	missense	probably benign
R7765:Fhdc1	UTSW	3	84444599	missense	probably benign	0.04
R8013:Fhdc1	UTSW	3	84474639	start codon destroyed	probably null	0.99
R8014:Fhdc1	UTSW	3	84474639	start codon destroyed	probably null	0.99
R8139:Fhdc1	UTSW	3	84451483	missense	probably damaging	1.00
R8264:Fhdc1	UTSW	3	84455032	missense	probably damaging	1.00
R8384:Fhdc1	UTSW	3	84454999	missense	possibly damaging	0.91
R8901:Fhdc1	UTSW	3	84445567	missense	probably benign
R9091:Fhdc1	UTSW	3	84444983	missense	unknown
R9270:Fhdc1	UTSW	3	84444983	missense	unknown
R9361:Fhdc1	UTSW	3	84448833	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCCTTGGAGGCAGAATCC -3'
(R):5'- GAGGAACTTCGGACACTTCG -3'

Sequencing Primer
(F):5'- AGAATCCTCGGAGCCACCTTTG -3'
(R):5'- TCGAGTGGCAGCATCAGTG -3'

Posted On

2015-06-24