Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Pds5b'

324168

Institutional Source

Beutler Lab

Gene Symbol

Pds5b

Ensembl Gene

ENSMUSG00000034021

Gene Name

PDS5 cohesin associated factor B

Synonyms

Aprin, AS3

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4342 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

150673739-150810690 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150800854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1301 (T1301A)

Ref Sequence

ENSEMBL: ENSMUSP00000038421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000110486] [ENSMUST00000202170]

AlphaFold

Q4VA53

Predicted Effect

probably benign
Transcript: ENSMUST00000016569
AA Change: T1299A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: T1299A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1247	1259	4.14e1	SMART
AT_hook	1285	1297	1.35e2	SMART
low complexity region	1307	1316	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC
AT_hook	1370	1382	1.46e0	SMART
low complexity region	1437	1446	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000038900
AA Change: T1301A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: T1301A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1373	1385	1.46e0	SMART
low complexity region	1440	1449	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110486

SMART Domains

Protein: ENSMUSP00000106112
Gene: ENSMUSG00000034021

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	520	5e-10	SMART
low complexity region	627	638	N/A	INTRINSIC
low complexity region	690	698	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201920

Predicted Effect

probably benign
Transcript: ENSMUST00000202170
AA Change: T1301A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: T1301A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1372	1384	1.46e0	SMART
low complexity region	1439	1448	N/A	INTRINSIC

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Pds5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Pds5b	APN	5	150722542	missense	probably benign	0.25
IGL01530:Pds5b	APN	5	150792175	missense	probably benign	0.38
IGL01812:Pds5b	APN	5	150780689	missense	probably damaging	1.00
IGL02163:Pds5b	APN	5	150756406	missense	probably benign	0.00
IGL02730:Pds5b	APN	5	150780752	splice site	probably benign
IGL02825:Pds5b	APN	5	150728970	missense	possibly damaging	0.90
IGL03143:Pds5b	APN	5	150779257	missense	probably damaging	1.00
IGL03379:Pds5b	APN	5	150788331	missense	probably damaging	1.00
PIT4283001:Pds5b	UTSW	5	150778309	missense	probably damaging	0.99
R0026:Pds5b	UTSW	5	150749830	splice site	probably benign
R0197:Pds5b	UTSW	5	150754431	missense	probably benign	0.28
R0347:Pds5b	UTSW	5	150736427	splice site	probably benign
R0396:Pds5b	UTSW	5	150779275	missense	possibly damaging	0.96
R0400:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R0442:Pds5b	UTSW	5	150716544	splice site	probably benign
R0745:Pds5b	UTSW	5	150805671	missense	probably benign
R0839:Pds5b	UTSW	5	150764962	missense	probably benign	0.23
R0866:Pds5b	UTSW	5	150739191	splice site	probably benign
R1247:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R1330:Pds5b	UTSW	5	150761077	missense	probably damaging	0.97
R1440:Pds5b	UTSW	5	150754417	missense	probably damaging	1.00
R1526:Pds5b	UTSW	5	150716400	splice site	probably null
R2010:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R2051:Pds5b	UTSW	5	150748190	missense	probably damaging	1.00
R2507:Pds5b	UTSW	5	150756428	missense	possibly damaging	0.90
R3111:Pds5b	UTSW	5	150719907	missense	probably damaging	1.00
R3820:Pds5b	UTSW	5	150736337	missense	possibly damaging	0.94
R3911:Pds5b	UTSW	5	150746706	missense	probably benign	0.41
R4077:Pds5b	UTSW	5	150794359	missense	possibly damaging	0.62
R4118:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R4416:Pds5b	UTSW	5	150736396	missense	probably damaging	1.00
R4503:Pds5b	UTSW	5	150728934	missense	probably damaging	1.00
R4524:Pds5b	UTSW	5	150788316	missense	probably damaging	1.00
R4579:Pds5b	UTSW	5	150746732	missense	probably damaging	0.98
R4623:Pds5b	UTSW	5	150800601	missense	probably benign	0.37
R4847:Pds5b	UTSW	5	150748112	missense	probably damaging	1.00
R4885:Pds5b	UTSW	5	150716462	missense	probably benign	0.21
R5271:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R5281:Pds5b	UTSW	5	150746608	missense	probably benign	0.26
R5337:Pds5b	UTSW	5	150793597	missense	probably benign	0.03
R5635:Pds5b	UTSW	5	150778221	missense	possibly damaging	0.78
R5677:Pds5b	UTSW	5	150716461	missense	possibly damaging	0.91
R6005:Pds5b	UTSW	5	150769776	splice site	probably null
R6139:Pds5b	UTSW	5	150800777	missense	possibly damaging	0.81
R6225:Pds5b	UTSW	5	150746618	missense	probably damaging	0.98
R6279:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6300:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6666:Pds5b	UTSW	5	150778166	missense	probably damaging	1.00
R6805:Pds5b	UTSW	5	150805561	splice site	probably null
R7038:Pds5b	UTSW	5	150800760	missense	probably benign	0.02
R7046:Pds5b	UTSW	5	150749920	missense	probably damaging	1.00
R7051:Pds5b	UTSW	5	150794282	missense	possibly damaging	0.78
R7138:Pds5b	UTSW	5	150800677	nonsense	probably null
R7255:Pds5b	UTSW	5	150796667	missense	probably benign	0.33
R7467:Pds5b	UTSW	5	150736327	missense	probably damaging	0.99
R7488:Pds5b	UTSW	5	150723337	missense	probably damaging	0.97
R7512:Pds5b	UTSW	5	150788342	missense	probably damaging	1.00
R7561:Pds5b	UTSW	5	150739318	critical splice donor site	probably null
R7576:Pds5b	UTSW	5	150778261	missense	probably damaging	1.00
R7889:Pds5b	UTSW	5	150792172	missense	probably damaging	1.00
R7982:Pds5b	UTSW	5	150769941	missense	probably damaging	1.00
R8059:Pds5b	UTSW	5	150807835	missense	unknown
R8211:Pds5b	UTSW	5	150728942	missense	possibly damaging	0.90
R8412:Pds5b	UTSW	5	150719959	missense	probably damaging	1.00
R8503:Pds5b	UTSW	5	150716507	missense	possibly damaging	0.95
R8556:Pds5b	UTSW	5	150792608	missense	probably benign
R8786:Pds5b	UTSW	5	150780669	missense	probably damaging	1.00
R8929:Pds5b	UTSW	5	150719914	missense	probably damaging	1.00
R8985:Pds5b	UTSW	5	150800774	missense	probably benign	0.38
R9184:Pds5b	UTSW	5	150800784	missense	probably benign	0.04
R9432:Pds5b	UTSW	5	150769791	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGTCACAGACCCTGAAG -3'
(R):5'- TCCACTTTAGCACTGCACAC -3'

Sequencing Primer
(F):5'- TGACCTAACTAAGTTGGTACAGG -3'
(R):5'- GCACACACTCACCTCTGTTGTG -3'

Posted On

2015-06-24