Incidental Mutation 'R4342:Vmn1r14'
ID 324169
Institutional Source Beutler Lab
Gene Symbol Vmn1r14
Ensembl Gene ENSMUSG00000114982
Gene Name vomeronasal 1 receptor 14
Synonyms V1rc7
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 57231686-57240885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57233823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 85 (Y85N)
Ref Sequence ENSEMBL: ENSMUSP00000153807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176376] [ENSMUST00000177435] [ENSMUST00000227209] [ENSMUST00000227574] [ENSMUST00000227768] [ENSMUST00000227884]
AlphaFold H3BJ46
Predicted Effect probably benign
Transcript: ENSMUST00000176376
AA Change: Y129N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134841
Gene: ENSMUSG00000093692
AA Change: Y129N

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:V1R 35 303 2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177435
AA Change: Y129N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000114982
AA Change: Y129N

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227209
AA Change: Y85N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000227574
AA Change: Y85N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000227768
AA Change: Y129N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227884
AA Change: Y129N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Vmn1r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1083:Vmn1r14 UTSW 6 57234199 missense probably damaging 1.00
R1533:Vmn1r14 UTSW 6 57234301 missense probably damaging 1.00
R1759:Vmn1r14 UTSW 6 57234312 missense probably benign 0.00
R3945:Vmn1r14 UTSW 6 57234269 missense probably benign 0.13
R4034:Vmn1r14 UTSW 6 57234325 missense possibly damaging 0.63
R4273:Vmn1r14 UTSW 6 57234148 missense probably damaging 1.00
R4451:Vmn1r14 UTSW 6 57234228 missense possibly damaging 0.86
R5978:Vmn1r14 UTSW 6 57233944 missense probably benign 0.06
R6378:Vmn1r14 UTSW 6 57233602 missense probably benign 0.09
R6829:Vmn1r14 UTSW 6 57233551 missense probably benign 0.06
R7153:Vmn1r14 UTSW 6 57233866 missense probably benign 0.10
R8015:Vmn1r14 UTSW 6 57234030 missense probably damaging 0.96
R8105:Vmn1r14 UTSW 6 57234260 missense probably benign 0.00
R8830:Vmn1r14 UTSW 6 57234032 missense probably damaging 0.98
R8831:Vmn1r14 UTSW 6 57233520 missense probably benign 0.05
Z1177:Vmn1r14 UTSW 6 57234141 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCCCATGGACTTGATCTCC -3'
(R):5'- CCCTGGAGCTTATCACTGTTAAAATC -3'

Sequencing Primer
(F):5'- CACATAATGATGTTCCTTGCTGGAG -3'
(R):5'- CAAACCCCTGATAATGTAGTTCATGG -3'
Posted On 2015-06-24