Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Mical3'

324173

Institutional Source

Beutler Lab

Gene Symbol

Mical3

Ensembl Gene

ENSMUSG00000051586

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 3

Synonyms

MICAL-3, C130040D16Rik

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120931707-121130999 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 120934838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1083 (E1083*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207889]

AlphaFold

Q8CJ19

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000098457

SMART Domains

Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
low complexity region	57	80	N/A	INTRINSIC
coiled coil region	114	148	N/A	INTRINSIC
low complexity region	191	225	N/A	INTRINSIC
coiled coil region	238	265	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC
low complexity region	374	383	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	582	592	N/A	INTRINSIC
low complexity region	625	637	N/A	INTRINSIC
low complexity region	794	824	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
low complexity region	911	929	N/A	INTRINSIC
low complexity region	950	962	N/A	INTRINSIC
DUF3585	968	1110	1.39e-65	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151602

Predicted Effect

probably null
Transcript: ENSMUST00000207889
AA Change: E1938*

Predicted Effect

probably null
Transcript: ENSMUST00000212333
AA Change: E1083*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Mical3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Mical3	APN	6	120961624	missense	possibly damaging	0.73
IGL00718:Mical3	APN	6	121040449	missense	probably damaging	0.98
IGL00940:Mical3	APN	6	121022410	missense	possibly damaging	0.55
IGL00973:Mical3	APN	6	120934924	splice site	probably benign
IGL01503:Mical3	APN	6	120958576	missense	probably benign	0.09
IGL01991:Mical3	APN	6	120935211	missense	probably damaging	0.98
IGL02794:Mical3	APN	6	121007309	missense	probably damaging	0.99
IGL02996:Mical3	APN	6	120958558	missense	probably damaging	1.00
IGL03105:Mical3	APN	6	121042238	missense	probably benign	0.01
IGL03109:Mical3	APN	6	121009124	missense	probably damaging	1.00
IGL03236:Mical3	APN	6	120969384	missense	probably benign	0.00
P0028:Mical3	UTSW	6	121024689	missense	probably benign	0.33
R0244:Mical3	UTSW	6	120957722	missense	probably benign	0.00
R0494:Mical3	UTSW	6	120959201	missense	possibly damaging	0.94
R0586:Mical3	UTSW	6	121029641	unclassified	probably benign
R1029:Mical3	UTSW	6	120934678	missense	probably benign	0.02
R1263:Mical3	UTSW	6	120952469	missense	probably damaging	0.99
R1507:Mical3	UTSW	6	121042238	missense	probably benign	0.36
R1527:Mical3	UTSW	6	121024779	missense	probably damaging	0.99
R1623:Mical3	UTSW	6	121024807	missense	probably damaging	0.99
R1680:Mical3	UTSW	6	120959643	missense	probably benign	0.09
R1697:Mical3	UTSW	6	121007408	missense	possibly damaging	0.84
R1817:Mical3	UTSW	6	121042235	missense	probably benign	0.06
R1875:Mical3	UTSW	6	121042064	missense	probably damaging	1.00
R1961:Mical3	UTSW	6	120982607	missense	possibly damaging	0.94
R2004:Mical3	UTSW	6	120951322	missense	probably damaging	1.00
R2093:Mical3	UTSW	6	121040386	missense	probably damaging	1.00
R2141:Mical3	UTSW	6	121031134	splice site	probably null
R2142:Mical3	UTSW	6	121031134	splice site	probably null
R2257:Mical3	UTSW	6	121033735	missense	possibly damaging	0.94
R2404:Mical3	UTSW	6	120959828	missense	probably benign	0.01
R2419:Mical3	UTSW	6	120959923	missense	probably benign
R2509:Mical3	UTSW	6	121034157	missense	probably damaging	1.00
R3784:Mical3	UTSW	6	121021337	missense	probably benign	0.00
R4343:Mical3	UTSW	6	120934838	nonsense	probably null
R4579:Mical3	UTSW	6	120958699	missense	probably benign
R4603:Mical3	UTSW	6	120934838	nonsense	probably null
R4605:Mical3	UTSW	6	121034080	nonsense	probably null
R4610:Mical3	UTSW	6	120934838	nonsense	probably null
R4611:Mical3	UTSW	6	120934838	nonsense	probably null
R4623:Mical3	UTSW	6	120961625	nonsense	probably null
R4669:Mical3	UTSW	6	120957703	missense	probably damaging	0.98
R4704:Mical3	UTSW	6	120958688	missense	probably benign	0.00
R4722:Mical3	UTSW	6	121038525	missense	probably benign	0.00
R4863:Mical3	UTSW	6	121033787	missense	probably damaging	0.99
R4878:Mical3	UTSW	6	120969387	missense	possibly damaging	0.51
R4885:Mical3	UTSW	6	120935253	missense	probably damaging	1.00
R4907:Mical3	UTSW	6	121007298	missense	probably benign	0.00
R5007:Mical3	UTSW	6	121038069	missense	probably damaging	0.98
R5299:Mical3	UTSW	6	120959512	missense	possibly damaging	0.71
R5303:Mical3	UTSW	6	120959980	missense	probably benign
R5368:Mical3	UTSW	6	120959473	missense	probably damaging	1.00
R5955:Mical3	UTSW	6	121033750	missense	probably damaging	0.99
R5970:Mical3	UTSW	6	120958271	nonsense	probably null
R6000:Mical3	UTSW	6	121021320	missense	probably benign	0.06
R6101:Mical3	UTSW	6	121033710	missense	probably damaging	1.00
R6195:Mical3	UTSW	6	121016835	intron	probably benign
R6210:Mical3	UTSW	6	121040517	splice site	probably null
R6225:Mical3	UTSW	6	120958723	missense	probably damaging	0.98
R6258:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6260:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6349:Mical3	UTSW	6	120959525	missense	probably benign
R6352:Mical3	UTSW	6	120952473	missense	probably damaging	0.97
R6480:Mical3	UTSW	6	121034275	missense	possibly damaging	0.76
R6704:Mical3	UTSW	6	121009800	intron	probably benign
R6783:Mical3	UTSW	6	120958825	missense	possibly damaging	0.85
R6925:Mical3	UTSW	6	120959390	missense	probably benign	0.05
R6960:Mical3	UTSW	6	120958543	missense	probably damaging	1.00
R7170:Mical3	UTSW	6	120973733	splice site	probably null
R7344:Mical3	UTSW	6	121036544	nonsense	probably null
R7414:Mical3	UTSW	6	121034113	missense	probably damaging	1.00
R7455:Mical3	UTSW	6	120958744	missense	probably damaging	1.00
R7649:Mical3	UTSW	6	120934948	missense	probably damaging	1.00
R8236:Mical3	UTSW	6	121012543	missense
R8286:Mical3	UTSW	6	121021188	missense	possibly damaging	0.68
R8316:Mical3	UTSW	6	120934983	missense	probably damaging	1.00
R8328:Mical3	UTSW	6	120935177	missense	probably damaging	0.98
R8354:Mical3	UTSW	6	120973420	missense	probably damaging	0.99
R8511:Mical3	UTSW	6	121038552	missense	possibly damaging	0.78
R8687:Mical3	UTSW	6	120959477	missense	probably benign	0.19
R8728:Mical3	UTSW	6	120973553	missense	probably damaging	0.99
R8925:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8927:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8986:Mical3	UTSW	6	121014861	missense
R9415:Mical3	UTSW	6	120957751	missense	probably damaging	1.00
U24488:Mical3	UTSW	6	121001496	missense	possibly damaging	0.90
Z1177:Mical3	UTSW	6	120959728	missense	possibly damaging	0.71
Z1190:Mical3	UTSW	6	121021358	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTACCAGACACAATGGCAGG -3'
(R):5'- CTCCAAGTCACTGTTGCTGTG -3'

Sequencing Primer
(F):5'- AATGGCAGGCGGGCTCAG -3'
(R):5'- AAGTCACTGTTGCTGTGTCTCC -3'

Posted On

2015-06-24