Incidental Mutation 'R4342:Olfr576'
ID 324174
Institutional Source Beutler Lab
Gene Symbol Olfr576
Ensembl Gene ENSMUSG00000073962
Gene Name olfactory receptor 576
Synonyms MOR8-5, GA_x6K02T2PBJ9-5676385-5677371
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102962660-102975160 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102966024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000143172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098213] [ENSMUST00000185326]
AlphaFold A0A0G2JFH3
Predicted Effect probably benign
Transcript: ENSMUST00000098213
AA Change: N308S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143172
Gene: ENSMUSG00000073962
AA Change: N308S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 301 6.2e-12 PFAM
Pfam:7tm_1 41 291 2.5e-29 PFAM
Pfam:7tm_4 140 284 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185326
SMART Domains Protein: ENSMUSP00000142459
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 300 9.7e-12 PFAM
Pfam:7tm_1 41 291 1.8e-29 PFAM
Pfam:7tm_4 140 284 2.6e-28 PFAM
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Olfr576
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Olfr576 APN 7 102966028 splice site probably benign
IGL01695:Olfr576 APN 7 102965583 missense probably damaging 0.97
IGL01707:Olfr576 APN 7 102965919 missense probably damaging 0.97
IGL02637:Olfr576 APN 7 102973043 utr 3 prime probably benign
R1636:Olfr576 UTSW 7 102965691 missense possibly damaging 0.94
R3077:Olfr576 UTSW 7 102966016 missense probably benign 0.06
R3079:Olfr576 UTSW 7 102973047 splice site probably null
R3803:Olfr576 UTSW 7 102966021 critical splice donor site probably null
R4866:Olfr576 UTSW 7 102965720 missense probably benign 0.01
R5193:Olfr576 UTSW 7 102965936 missense possibly damaging 0.52
R5194:Olfr576 UTSW 7 102965864 missense probably benign 0.01
R9002:Olfr576 UTSW 7 102965411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCTAAATACCTGTGTCTCC -3'
(R):5'- CAATTACTGCAAATGTTCTCAACCC -3'

Sequencing Primer
(F):5'- ACATCTGTGCTGTGCTCATC -3'
(R):5'- GCAAATGTTCTCAACCCGATTATAAG -3'
Posted On 2015-06-24