Incidental Mutation 'R4342:Evi5l'
ID 324176
Institutional Source Beutler Lab
Gene Symbol Evi5l
Ensembl Gene ENSMUSG00000011832
Gene Name ecotropic viral integration site 5 like
Synonyms
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4166567-4211257 bp(+) (GRCm38)
Type of Mutation utr 5 prime
DNA Base Change (assembly) A to C at 4183492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176764] [ENSMUST00000176825] [ENSMUST00000177053]
AlphaFold H3BKQ3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148353
Predicted Effect probably benign
Transcript: ENSMUST00000176072
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176149
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176462
Predicted Effect probably benign
Transcript: ENSMUST00000176764
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176825
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177053
SMART Domains Protein: ENSMUSP00000135159
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 3e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177499
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Evi5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Evi5l APN 8 4193219 critical splice donor site probably null
IGL02143:Evi5l APN 8 4191293 missense probably damaging 0.99
IGL02322:Evi5l APN 8 4187236 splice site probably benign
IGL02528:Evi5l APN 8 4193172 missense probably benign 0.25
IGL02822:Evi5l APN 8 4187248 missense probably damaging 1.00
R0280:Evi5l UTSW 8 4193133 missense probably damaging 1.00
R1764:Evi5l UTSW 8 4203560 missense probably damaging 0.98
R2032:Evi5l UTSW 8 4210622 missense probably damaging 1.00
R2158:Evi5l UTSW 8 4193195 missense probably damaging 0.99
R2175:Evi5l UTSW 8 4187269 missense probably damaging 1.00
R2357:Evi5l UTSW 8 4193113 splice site probably benign
R3055:Evi5l UTSW 8 4191603 nonsense probably null
R3724:Evi5l UTSW 8 4178080 intron probably benign
R3956:Evi5l UTSW 8 4191358 missense possibly damaging 0.72
R4621:Evi5l UTSW 8 4202909 intron probably benign
R4622:Evi5l UTSW 8 4202909 intron probably benign
R4959:Evi5l UTSW 8 4205406 missense probably benign 0.00
R4973:Evi5l UTSW 8 4205406 missense probably benign 0.00
R5052:Evi5l UTSW 8 4206019 intron probably benign
R5097:Evi5l UTSW 8 4193317 missense probably damaging 0.97
R5344:Evi5l UTSW 8 4185990 missense possibly damaging 0.78
R5357:Evi5l UTSW 8 4203623 missense possibly damaging 0.63
R5376:Evi5l UTSW 8 4210770 missense probably damaging 0.99
R5382:Evi5l UTSW 8 4178653 intron probably benign
R5500:Evi5l UTSW 8 4191658 missense probably damaging 0.96
R5554:Evi5l UTSW 8 4206491 splice site probably benign
R5689:Evi5l UTSW 8 4205460 nonsense probably null
R5788:Evi5l UTSW 8 4206800 utr 3 prime probably benign
R6321:Evi5l UTSW 8 4203080 missense probably benign
R6520:Evi5l UTSW 8 4205906 missense possibly damaging 0.76
R6620:Evi5l UTSW 8 4206674 missense possibly damaging 0.84
R6707:Evi5l UTSW 8 4206322 missense probably benign
R7232:Evi5l UTSW 8 4205906 missense possibly damaging 0.71
R7692:Evi5l UTSW 8 4200886 missense probably damaging 1.00
R7985:Evi5l UTSW 8 4203536 missense probably benign 0.27
R8162:Evi5l UTSW 8 4191300 missense probably damaging 1.00
R8474:Evi5l UTSW 8 4210784 missense possibly damaging 0.94
R8512:Evi5l UTSW 8 4193121 missense probably benign 0.01
R8758:Evi5l UTSW 8 4205860 missense probably benign 0.13
R8970:Evi5l UTSW 8 4186154 splice site probably benign
R9138:Evi5l UTSW 8 4183582 missense probably benign 0.03
X0062:Evi5l UTSW 8 4191303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTGCTGGATTTGAGCC -3'
(R):5'- AGGAAGCCAGGAATCAGCTC -3'

Sequencing Primer
(F):5'- CCTTGGTTGTTGGTTGTAGCACATAG -3'
(R):5'- GCCAGGAATCAGCTCCCTCC -3'
Posted On 2015-06-24