Incidental Mutation 'R4342:Cers4'
ID 324177
Institutional Source Beutler Lab
Gene Symbol Cers4
Ensembl Gene ENSMUSG00000008206
Gene Name ceramide synthase 4
Synonyms Lass4, CerS4, Trh1, 2900019C14Rik
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4493026-4531680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4521223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 264 (L264P)
Ref Sequence ENSEMBL: ENSMUSP00000008350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008350] [ENSMUST00000176130]
AlphaFold Q9D6J1
Predicted Effect probably damaging
Transcript: ENSMUST00000008350
AA Change: L264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008350
Gene: ENSMUSG00000008206
AA Change: L264P

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175781
SMART Domains Protein: ENSMUSP00000138819
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176130
SMART Domains Protein: ENSMUSP00000135652
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
transmembrane domain 39 56 N/A INTRINSIC
HOX 75 132 1.2e-4 SMART
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177010
SMART Domains Protein: ENSMUSP00000135763
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 58 7e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193830
Meta Mutation Damage Score 0.8801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered lipid composition of the sebum and hair follicle dystrophy that results in a progressive form of alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Cers4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cers4 APN 8 4521216 missense probably benign 0.13
IGL02407:Cers4 APN 8 4520306 nonsense probably null
IGL03244:Cers4 APN 8 4516878 missense probably damaging 0.99
Radlauer UTSW 8 4519475 missense probably damaging 1.00
willis UTSW 8 4518269 nonsense probably null
R1170:Cers4 UTSW 8 4519475 missense probably damaging 1.00
R1177:Cers4 UTSW 8 4516931 missense probably null 0.00
R1346:Cers4 UTSW 8 4515632 missense probably damaging 1.00
R1506:Cers4 UTSW 8 4520557 missense probably benign 0.30
R1652:Cers4 UTSW 8 4516908 splice site probably null
R1819:Cers4 UTSW 8 4521232 missense probably benign 0.00
R1952:Cers4 UTSW 8 4523461 nonsense probably null
R3790:Cers4 UTSW 8 4518285 missense possibly damaging 0.87
R5001:Cers4 UTSW 8 4515565 missense probably benign 0.33
R5338:Cers4 UTSW 8 4515680 missense probably damaging 0.98
R5785:Cers4 UTSW 8 4516992 critical splice donor site probably null
R5980:Cers4 UTSW 8 4518269 nonsense probably null
R6315:Cers4 UTSW 8 4516980 missense probably benign 0.02
R6891:Cers4 UTSW 8 4523731 missense probably damaging 0.99
R7554:Cers4 UTSW 8 4515718 missense probably benign
R7921:Cers4 UTSW 8 4515704 missense probably damaging 0.97
R8368:Cers4 UTSW 8 4515698 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATATGGCCTTACCTTAGTTCAC -3'
(R):5'- CTGCATTACACTAGTGCTGCAC -3'

Sequencing Primer
(F):5'- AGTTCACATGGCTTCACCCCATAG -3'
(R):5'- CATATGTTGTGCTCTGCAAAAATCCC -3'
Posted On 2015-06-24