Incidental Mutation 'R4342:Nr1d1'
ID 324187
Institutional Source Beutler Lab
Gene Symbol Nr1d1
Ensembl Gene ENSMUSG00000020889
Gene Name nuclear receptor subfamily 1, group D, member 1
Synonyms REV-ERBalpha, rev-erbA(alpha), A530070C09Rik
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 98767932-98775333 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 98771814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 118 (K118Q)
Ref Sequence ENSEMBL: ENSMUSP00000069505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000124072]
AlphaFold Q3UV55
Predicted Effect probably benign
Transcript: ENSMUST00000064187
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064941
AA Change: K118Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889
AA Change: K118Q

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124072
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139220
Meta Mutation Damage Score 0.1561 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (Arntl). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered circadian behavior and temperature regulation with mild alterations in cytoarchitecture of the cerebellum. Litter size is reduced by half in mutant females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Nr1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Nr1d1 UTSW 11 98770478 missense probably benign
R1485:Nr1d1 UTSW 11 98770361 missense probably benign
R1801:Nr1d1 UTSW 11 98771499 missense probably damaging 1.00
R2090:Nr1d1 UTSW 11 98770610 missense probably damaging 0.99
R4622:Nr1d1 UTSW 11 98769884 missense probably damaging 1.00
R4658:Nr1d1 UTSW 11 98771912 missense possibly damaging 0.80
R4664:Nr1d1 UTSW 11 98771260 missense possibly damaging 0.95
R4770:Nr1d1 UTSW 11 98770645 missense probably benign 0.28
R5408:Nr1d1 UTSW 11 98770261 missense probably benign 0.02
R5677:Nr1d1 UTSW 11 98771308 missense probably damaging 1.00
R5713:Nr1d1 UTSW 11 98770411 missense probably benign 0.00
R6244:Nr1d1 UTSW 11 98770537 missense probably damaging 1.00
R6429:Nr1d1 UTSW 11 98772014 missense probably damaging 1.00
R6875:Nr1d1 UTSW 11 98770836 splice site probably null
R7073:Nr1d1 UTSW 11 98772066 missense probably damaging 0.99
R7100:Nr1d1 UTSW 11 98771334 missense probably damaging 1.00
R7900:Nr1d1 UTSW 11 98769711 missense probably benign 0.10
R8296:Nr1d1 UTSW 11 98771307 missense probably damaging 1.00
R8678:Nr1d1 UTSW 11 98769247 missense probably damaging 1.00
R8679:Nr1d1 UTSW 11 98769247 missense probably damaging 1.00
R8757:Nr1d1 UTSW 11 98769247 missense probably damaging 1.00
R8759:Nr1d1 UTSW 11 98769247 missense probably damaging 1.00
R9195:Nr1d1 UTSW 11 98769057 missense possibly damaging 0.80
X0018:Nr1d1 UTSW 11 98770829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTCAAGGTTCTAGGAG -3'
(R):5'- TCCCTGACTCAAGGTTGTCC -3'

Sequencing Primer
(F):5'- GCTCTCACGTCTAGGTGACTG -3'
(R):5'- TGACTCAAGGTTGTCCCACATAC -3'
Posted On 2015-06-24