Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Tex2'

324189

Institutional Source

Beutler Lab

Gene Symbol

Tex2

Ensembl Gene

ENSMUSG00000040548

Gene Name

testis expressed gene 2

Synonyms

Def-5, Taz4, 4930568E07Rik

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106502147-106613423 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 106567006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042780] [ENSMUST00000103070] [ENSMUST00000128933] [ENSMUST00000153870]

AlphaFold

Q6ZPJ0

Predicted Effect

unknown
Transcript: ENSMUST00000042780
AA Change: S533G

SMART Domains

Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548
AA Change: S533G

Domain	Start	End	E-Value	Type
low complexity region	119	186	N/A	INTRINSIC
low complexity region	319	341	N/A	INTRINSIC
low complexity region	346	360	N/A	INTRINSIC
transmembrane domain	473	492	N/A	INTRINSIC
transmembrane domain	494	516	N/A	INTRINSIC
PH	543	712	5.05e-1	SMART
low complexity region	732	752	N/A	INTRINSIC
low complexity region	811	823	N/A	INTRINSIC
low complexity region	946	965	N/A	INTRINSIC
low complexity region	1003	1016	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000103070
AA Change: S533G

SMART Domains

Protein: ENSMUSP00000099359
Gene: ENSMUSG00000040548
AA Change: S533G

Domain	Start	End	E-Value	Type
low complexity region	119	186	N/A	INTRINSIC
low complexity region	319	341	N/A	INTRINSIC
low complexity region	346	360	N/A	INTRINSIC
transmembrane domain	473	492	N/A	INTRINSIC
transmembrane domain	494	516	N/A	INTRINSIC
PH	543	712	5.05e-1	SMART
low complexity region	732	752	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128933

SMART Domains

Protein: ENSMUSP00000120781
Gene: ENSMUSG00000040548

Domain	Start	End	E-Value	Type
low complexity region	119	168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153870

Predicted Effect

unknown
Transcript: ENSMUST00000207249
AA Change: S35G

Meta Mutation Damage Score

0.0860

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Tex2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Tex2	APN	11	106568535	missense	probably damaging	1.00
IGL01380:Tex2	APN	11	106544315	nonsense	probably null
IGL02607:Tex2	APN	11	106546747	missense	unknown
IGL02680:Tex2	APN	11	106568232	unclassified	probably benign
IGL02699:Tex2	APN	11	106568433	missense	possibly damaging	0.53
IGL03187:Tex2	APN	11	106568077	unclassified	probably benign
IGL03398:Tex2	APN	11	106568272	missense	probably damaging	1.00
R0242:Tex2	UTSW	11	106519955	nonsense	probably null
R0242:Tex2	UTSW	11	106519955	nonsense	probably null
R1085:Tex2	UTSW	11	106568487	missense	probably damaging	0.98
R1491:Tex2	UTSW	11	106503640	missense	possibly damaging	0.72
R1664:Tex2	UTSW	11	106567782	unclassified	probably benign
R1794:Tex2	UTSW	11	106567902	unclassified	probably benign
R1855:Tex2	UTSW	11	106546876	missense	possibly damaging	0.87
R2077:Tex2	UTSW	11	106506864	splice site	probably null
R2151:Tex2	UTSW	11	106567335	unclassified	probably benign
R2175:Tex2	UTSW	11	106503687	missense	unknown
R2984:Tex2	UTSW	11	106546663	critical splice donor site	probably null
R3156:Tex2	UTSW	11	106533869	critical splice donor site	probably null
R3722:Tex2	UTSW	11	106546740	nonsense	probably null
R3724:Tex2	UTSW	11	106529330	missense	unknown
R3770:Tex2	UTSW	11	106544252	missense	unknown
R3771:Tex2	UTSW	11	106546894	missense	unknown
R3813:Tex2	UTSW	11	106511944	missense	unknown
R3947:Tex2	UTSW	11	106520003	missense	unknown
R4206:Tex2	UTSW	11	106567572	unclassified	probably benign
R4554:Tex2	UTSW	11	106544386	missense	unknown
R4896:Tex2	UTSW	11	106568404	missense	probably damaging	1.00
R5207:Tex2	UTSW	11	106546840	missense	unknown
R5249:Tex2	UTSW	11	106546789	missense	unknown
R5257:Tex2	UTSW	11	106567759	unclassified	probably benign
R5258:Tex2	UTSW	11	106567759	unclassified	probably benign
R5278:Tex2	UTSW	11	106567813	missense	probably benign	0.34
R5702:Tex2	UTSW	11	106544395	missense	possibly damaging	0.58
R5835:Tex2	UTSW	11	106519913	missense	unknown
R6150:Tex2	UTSW	11	106567080	missense	probably benign	0.34
R6785:Tex2	UTSW	11	106533950	missense	probably damaging	1.00
R6879:Tex2	UTSW	11	106534010	missense	unknown
R7038:Tex2	UTSW	11	106511900	critical splice donor site	probably null
R7117:Tex2	UTSW	11	106544245	missense	unknown
R7336:Tex2	UTSW	11	106548859	missense	unknown
R7568:Tex2	UTSW	11	106548736	missense	unknown
R7622:Tex2	UTSW	11	106546895	missense	unknown
R8228:Tex2	UTSW	11	106567171	missense	probably benign	0.34
R8407:Tex2	UTSW	11	106568395	missense	probably damaging	1.00
R8807:Tex2	UTSW	11	106544368	missense	unknown
R8807:Tex2	UTSW	11	106567588	missense	unknown
R8882:Tex2	UTSW	11	106544236	missense	unknown
R8926:Tex2	UTSW	11	106568404	missense
R8936:Tex2	UTSW	11	106567318	nonsense	probably null
R8988:Tex2	UTSW	11	106511905	missense	unknown
R9165:Tex2	UTSW	11	106567269	missense	unknown
R9294:Tex2	UTSW	11	106568535	missense	probably damaging	1.00
R9314:Tex2	UTSW	11	106544249	missense	unknown
R9405:Tex2	UTSW	11	106544388	missense	unknown
R9419:Tex2	UTSW	11	106567009	nonsense	probably null
T0970:Tex2	UTSW	11	106546946	missense	unknown
Z1177:Tex2	UTSW	11	106534008	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGCTGTTTGAGTTCCTGGAC -3'
(R):5'- AGACGCTCGGCTTCTTTATAATG -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ATAATGTGTGTCTACGCGTACC -3'

Posted On

2015-06-24