Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Itgb4'

324190

Institutional Source

Beutler Lab

Gene Symbol

Itgb4

Ensembl Gene

ENSMUSG00000020758

Gene Name

integrin beta 4

Synonyms

CD104

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115974709-116008412 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115988729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 614 (T614S)

Ref Sequence

ENSEMBL: ENSMUSP00000127604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]

AlphaFold

A2A863

Predicted Effect

probably benign
Transcript: ENSMUST00000021107
AA Change: T614S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	712	1.32e-28	SMART
low complexity region	715	732	N/A	INTRINSIC
transmembrane domain	737	756	N/A	INTRINSIC
Calx_beta	980	1085	3.13e-35	SMART
FN3	1125	1203	3.15e-8	SMART
FN3	1218	1305	6.29e-8	SMART
low complexity region	1324	1332	N/A	INTRINSIC
FN3	1508	1589	1.79e-12	SMART
FN3	1621	1705	1.7e-13	SMART
low complexity region	1738	1751	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000068981
AA Change: T614S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	713	7.06e-29	SMART
low complexity region	716	733	N/A	INTRINSIC
transmembrane domain	738	757	N/A	INTRINSIC
Calx_beta	981	1086	3.13e-35	SMART
FN3	1129	1207	3.15e-8	SMART
FN3	1222	1309	6.29e-8	SMART
low complexity region	1328	1336	N/A	INTRINSIC
FN3	1459	1540	1.79e-12	SMART
FN3	1572	1656	1.7e-13	SMART
low complexity region	1689	1702	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106458
AA Change: T614S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	713	7.06e-29	SMART
low complexity region	716	733	N/A	INTRINSIC
transmembrane domain	738	757	N/A	INTRINSIC
Calx_beta	981	1086	3.13e-35	SMART
FN3	1129	1207	3.15e-8	SMART
FN3	1222	1309	6.29e-8	SMART
low complexity region	1328	1336	N/A	INTRINSIC
low complexity region	1413	1425	N/A	INTRINSIC
FN3	1524	1605	1.79e-12	SMART
FN3	1637	1721	1.7e-13	SMART
low complexity region	1754	1767	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106460
AA Change: T614S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	713	7.06e-29	SMART
low complexity region	716	733	N/A	INTRINSIC
transmembrane domain	738	757	N/A	INTRINSIC
Calx_beta	981	1086	3.13e-35	SMART
FN3	1129	1207	3.15e-8	SMART
FN3	1222	1309	6.29e-8	SMART
low complexity region	1328	1336	N/A	INTRINSIC
FN3	1512	1593	1.79e-12	SMART
FN3	1625	1709	1.7e-13	SMART
low complexity region	1742	1755	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106461
AA Change: T614S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	713	7.06e-29	SMART
low complexity region	716	733	N/A	INTRINSIC
transmembrane domain	738	757	N/A	INTRINSIC
Calx_beta	981	1086	3.13e-35	SMART
FN3	1129	1207	3.15e-8	SMART
FN3	1222	1309	6.29e-8	SMART
low complexity region	1328	1336	N/A	INTRINSIC
low complexity region	1413	1425	N/A	INTRINSIC
FN3	1524	1605	1.79e-12	SMART
FN3	1637	1721	1.7e-13	SMART
low complexity region	1754	1767	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130286

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151691

Predicted Effect

probably benign
Transcript: ENSMUST00000169928
AA Change: T614S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: T614S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
PSI	30	74	3.89e-1	SMART
INB	38	457	4.23e-213	SMART
VWA	130	361	8.29e-1	SMART
EGF_like	544	576	3.23e1	SMART
Integrin_B_tail	628	712	1.32e-28	SMART
low complexity region	715	732	N/A	INTRINSIC
transmembrane domain	737	756	N/A	INTRINSIC
Calx_beta	980	1085	3.13e-35	SMART
FN3	1125	1203	3.15e-8	SMART
FN3	1218	1305	6.29e-8	SMART
low complexity region	1324	1332	N/A	INTRINSIC
FN3	1508	1589	1.79e-12	SMART
FN3	1621	1705	1.7e-13	SMART
low complexity region	1738	1751	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180782

Meta Mutation Damage Score

0.1166

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Itgb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Itgb4	APN	11	115990940	missense	probably damaging	1.00
IGL01391:Itgb4	APN	11	115990920	missense	probably damaging	1.00
IGL01431:Itgb4	APN	11	116006457	splice site	probably benign
IGL01750:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL01752:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL01756:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL01766:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL01769:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL02188:Itgb4	APN	11	116003387	missense	probably benign	0.08
IGL02262:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL02293:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL02318:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL02319:Itgb4	APN	11	115988926	missense	probably damaging	0.99
IGL02338:Itgb4	APN	11	116007969	missense	probably damaging	1.00
IGL02734:Itgb4	APN	11	116005966	missense	probably benign
IGL02879:Itgb4	APN	11	115994352	missense	probably benign	0.05
IGL02889:Itgb4	APN	11	115988905	missense	probably damaging	1.00
IGL03183:Itgb4	APN	11	115988724	missense	probably damaging	1.00
IGL03054:Itgb4	UTSW	11	116000340	nonsense	probably null
R0021:Itgb4	UTSW	11	115979627	missense	possibly damaging	0.95
R0092:Itgb4	UTSW	11	115979124	missense	probably damaging	1.00
R0305:Itgb4	UTSW	11	115979412	missense	probably damaging	1.00
R0408:Itgb4	UTSW	11	116007602	missense	probably damaging	0.99
R0465:Itgb4	UTSW	11	115979756	missense	probably damaging	1.00
R0499:Itgb4	UTSW	11	115979695	missense	probably benign	0.00
R0535:Itgb4	UTSW	11	115991009	missense	possibly damaging	0.86
R0571:Itgb4	UTSW	11	115979768	missense	possibly damaging	0.94
R0613:Itgb4	UTSW	11	115993342	missense	probably damaging	0.98
R0838:Itgb4	UTSW	11	115998162	intron	probably benign
R1381:Itgb4	UTSW	11	115994337	missense	probably benign	0.00
R1451:Itgb4	UTSW	11	115990884	missense	probably damaging	1.00
R1459:Itgb4	UTSW	11	115979111	missense	probably benign	0.42
R1460:Itgb4	UTSW	11	115984164	missense	probably damaging	0.96
R1473:Itgb4	UTSW	11	115984047	missense	probably benign	0.01
R1484:Itgb4	UTSW	11	115999799	missense	probably benign	0.01
R1593:Itgb4	UTSW	11	115980991	missense	probably damaging	1.00
R1623:Itgb4	UTSW	11	115991316	nonsense	probably null
R1633:Itgb4	UTSW	11	116007760	missense	probably damaging	1.00
R1642:Itgb4	UTSW	11	116007357	missense	probably damaging	1.00
R1669:Itgb4	UTSW	11	115991330	missense	probably benign	0.07
R1713:Itgb4	UTSW	11	116003489	missense	probably damaging	1.00
R1732:Itgb4	UTSW	11	115988918	missense	probably damaging	1.00
R1791:Itgb4	UTSW	11	115988520	missense	probably damaging	1.00
R1847:Itgb4	UTSW	11	115983764	missense	probably benign	0.31
R1902:Itgb4	UTSW	11	115980738	missense	probably damaging	0.98
R1945:Itgb4	UTSW	11	115993453	nonsense	probably null
R2102:Itgb4	UTSW	11	116005735	missense	probably benign	0.23
R2184:Itgb4	UTSW	11	115979624	missense	probably damaging	0.96
R2334:Itgb4	UTSW	11	115993435	missense	probably damaging	1.00
R2401:Itgb4	UTSW	11	116006563	missense	possibly damaging	0.67
R3743:Itgb4	UTSW	11	116003670	missense	probably damaging	1.00
R3938:Itgb4	UTSW	11	116005926	missense	possibly damaging	0.92
R4134:Itgb4	UTSW	11	116006470	missense	probably benign	0.03
R4280:Itgb4	UTSW	11	115990935	missense	probably damaging	1.00
R4434:Itgb4	UTSW	11	115999814	missense	probably benign	0.10
R4505:Itgb4	UTSW	11	115983261	splice site	silent
R4585:Itgb4	UTSW	11	115993325	missense	probably damaging	1.00
R4586:Itgb4	UTSW	11	115993325	missense	probably damaging	1.00
R4601:Itgb4	UTSW	11	116005722	missense	probably damaging	1.00
R4921:Itgb4	UTSW	11	116006605	missense	probably benign	0.12
R4962:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5027:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5029:Itgb4	UTSW	11	115988591	intron	probably benign
R5084:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5085:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5124:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5125:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5150:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5175:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5176:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5179:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5207:Itgb4	UTSW	11	116006539	missense	probably damaging	1.00
R5263:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5264:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5334:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5337:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5344:Itgb4	UTSW	11	115989749	missense	probably null	0.92
R5391:Itgb4	UTSW	11	115985068	missense	probably benign	0.05
R5437:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5440:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5653:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5654:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5655:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5772:Itgb4	UTSW	11	115988432	intron	probably benign
R5812:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5813:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5814:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5863:Itgb4	UTSW	11	115990922	missense	probably damaging	1.00
R5864:Itgb4	UTSW	11	115990922	missense	probably damaging	1.00
R5865:Itgb4	UTSW	11	115990922	missense	probably damaging	1.00
R5951:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5954:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R5982:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6043:Itgb4	UTSW	11	115979386	missense	probably benign	0.30
R6133:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6134:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6135:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6169:Itgb4	UTSW	11	115994276	missense	probably damaging	0.98
R6172:Itgb4	UTSW	11	116000411	missense	probably benign	0.23
R6255:Itgb4	UTSW	11	115998137	missense	possibly damaging	0.83
R6258:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6259:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6260:Itgb4	UTSW	11	115984157	missense	probably benign	0.00
R6612:Itgb4	UTSW	11	115984071	missense	probably benign	0.00
R7037:Itgb4	UTSW	11	116005565	nonsense	probably null
R7371:Itgb4	UTSW	11	115998080	missense	probably benign	0.29
R7605:Itgb4	UTSW	11	116006476	missense	probably benign	0.01
R7659:Itgb4	UTSW	11	115979731	missense	probably damaging	1.00
R7759:Itgb4	UTSW	11	116003710	missense	possibly damaging	0.92
R7804:Itgb4	UTSW	11	116003684	missense	probably damaging	1.00
R7832:Itgb4	UTSW	11	116000261	missense	probably damaging	1.00
R7842:Itgb4	UTSW	11	115982705	missense	probably benign	0.18
R7923:Itgb4	UTSW	11	115982699	critical splice acceptor site	probably null
R8004:Itgb4	UTSW	11	115982705	missense	probably benign	0.00
R8143:Itgb4	UTSW	11	115993429	missense	probably damaging	1.00
R8427:Itgb4	UTSW	11	115991718	critical splice donor site	probably null
R8857:Itgb4	UTSW	11	115981027	missense	probably benign	0.04
R8863:Itgb4	UTSW	11	115985072	nonsense	probably null
R8932:Itgb4	UTSW	11	115988469	missense	probably benign	0.01
R9153:Itgb4	UTSW	11	115984053	missense	probably benign	0.00
R9207:Itgb4	UTSW	11	116007097	missense	probably damaging	1.00
R9239:Itgb4	UTSW	11	116007304	missense	probably damaging	1.00
R9267:Itgb4	UTSW	11	115979639	missense	probably benign
R9289:Itgb4	UTSW	11	115994361	missense	probably benign	0.01
R9328:Itgb4	UTSW	11	115989799	missense	probably benign	0.00
R9435:Itgb4	UTSW	11	116005029	missense	probably benign	0.01
X0062:Itgb4	UTSW	11	115993452	missense	probably damaging	1.00
Z1176:Itgb4	UTSW	11	116006520	missense	probably damaging	1.00
Z1177:Itgb4	UTSW	11	115986811	missense	probably damaging	0.99
Z1177:Itgb4	UTSW	11	115998058	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTGCATCGATAGCAACGG -3'
(R):5'- TTAAAGGGGCAATCGTCACAC -3'

Sequencing Primer
(F):5'- CAACGGGGTAAGGCCTG -3'
(R):5'- GCGGAGATCCTCACAGAGAC -3'

Posted On

2015-06-24