Incidental Mutation 'R4342:Hoxc11'
ID 324202
Institutional Source Beutler Lab
Gene Symbol Hoxc11
Ensembl Gene ENSMUSG00000001656
Gene Name homeobox C11
Synonyms Hox-3.7
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102954427-102957708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102954671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 49 (S49F)
Ref Sequence ENSEMBL: ENSMUSP00000001701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001701]
AlphaFold P31313
Predicted Effect probably damaging
Transcript: ENSMUST00000001701
AA Change: S49F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001701
Gene: ENSMUSG00000001656
AA Change: S49F

DomainStartEndE-ValueType
Pfam:DUF3528 42 178 5.2e-52 PFAM
low complexity region 193 204 N/A INTRINSIC
low complexity region 209 216 N/A INTRINSIC
HOX 232 294 1.66e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183814
Meta Mutation Damage Score 0.2572 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene binds to a promoter element of the lactase-phlorizin hydrolase. It also may play a role in early intestinal development. An alternatively spliced variant encoding a shorter isoform has been described but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Hoxc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03122:Hoxc11 APN 15 102954955 missense probably damaging 1.00
IGL03261:Hoxc11 APN 15 102954743 missense probably benign 0.36
R0008:Hoxc11 UTSW 15 102954962 missense probably damaging 1.00
R0008:Hoxc11 UTSW 15 102954962 missense probably damaging 1.00
R0157:Hoxc11 UTSW 15 102955001 missense probably damaging 1.00
R1055:Hoxc11 UTSW 15 102954835 missense probably damaging 1.00
R1681:Hoxc11 UTSW 15 102955156 missense possibly damaging 0.92
R6285:Hoxc11 UTSW 15 102954743 missense probably benign 0.36
R6558:Hoxc11 UTSW 15 102954866 missense probably damaging 1.00
R7211:Hoxc11 UTSW 15 102955052 missense possibly damaging 0.82
R8346:Hoxc11 UTSW 15 102954751 missense possibly damaging 0.93
R8348:Hoxc11 UTSW 15 102954751 missense possibly damaging 0.93
R8423:Hoxc11 UTSW 15 102954742 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CGCTAGATCGGGTCCAAAAC -3'
(R):5'- TTTTCATGAGGATCTCAGTGACTG -3'

Sequencing Primer
(F):5'- GTCCAAAACCTCCAGCCGG -3'
(R):5'- TCTCAGTGACTGTGGAAGGAG -3'
Posted On 2015-06-24