Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Greb1l'

324207

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

041100-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10544561 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1385 (M1385K)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: M1385K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M1385K

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.1176

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTGATATACCTGTTCAGGATGG -3'
(R):5'- TTTGAGCCCTAGCAAGCAAG -3'

Sequencing Primer
(F):5'- ATATACCTGTTCAGGATGGTGGTGAG -3'
(R):5'- AAGTCAAGATGTGCCTGTTCATG -3'

Posted On

2015-06-24