Incidental Mutation 'R4342:Slc22a12'
ID 324209
Institutional Source Beutler Lab
Gene Symbol Slc22a12
Ensembl Gene ENSMUSG00000061742
Gene Name solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms Rst, URAT1
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6535845-6543019 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6541099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 156 (I156T)
Ref Sequence ENSEMBL: ENSMUSP00000109078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000113451
AA Change: I156T

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: I156T

DomainStartEndE-ValueType
Pfam:Sugar_tr 95 525 2e-26 PFAM
Pfam:MFS_1 128 484 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113459
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126142
AA Change: I142T
SMART Domains Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: I142T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 229 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153483
Meta Mutation Damage Score 0.1345 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Slc22a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Slc22a12 APN 19 6537814 missense probably benign 0.19
IGL02586:Slc22a12 APN 19 6540457 missense probably benign 0.03
mutual UTSW 19 6542653 nonsense probably null
reinforcement UTSW 19 6537169 missense probably benign 0.03
R1353:Slc22a12 UTSW 19 6537782 missense possibly damaging 0.66
R1757:Slc22a12 UTSW 19 6536731 splice site probably null
R1816:Slc22a12 UTSW 19 6542653 nonsense probably null
R2254:Slc22a12 UTSW 19 6542541 missense possibly damaging 0.86
R4110:Slc22a12 UTSW 19 6540628 missense probably damaging 1.00
R4125:Slc22a12 UTSW 19 6538788 missense probably damaging 0.99
R4762:Slc22a12 UTSW 19 6538444 missense probably benign 0.02
R4927:Slc22a12 UTSW 19 6537761 missense probably benign 0.23
R5690:Slc22a12 UTSW 19 6536848 missense probably benign 0.00
R5772:Slc22a12 UTSW 19 6540449 missense possibly damaging 0.67
R5946:Slc22a12 UTSW 19 6537851 missense probably damaging 1.00
R6137:Slc22a12 UTSW 19 6542724 missense probably benign 0.07
R7740:Slc22a12 UTSW 19 6537169 missense probably benign 0.03
R7978:Slc22a12 UTSW 19 6536908 missense possibly damaging 0.84
R8028:Slc22a12 UTSW 19 6538439 missense probably benign 0.15
R8508:Slc22a12 UTSW 19 6542437 missense probably benign 0.03
R8992:Slc22a12 UTSW 19 6542484 missense possibly damaging 0.62
X0062:Slc22a12 UTSW 19 6537127 missense probably damaging 1.00
Z1088:Slc22a12 UTSW 19 6538463 missense possibly damaging 0.54
Z1177:Slc22a12 UTSW 19 6540401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGTTAGCAAGTGAATTCCC -3'
(R):5'- ACGCAGTATAGGGCTGACAG -3'

Sequencing Primer
(F):5'- AGTGAATTCCCCCTTAGCAGAGG -3'
(R):5'- CAGTATAGGGCTGACAGGATACTCC -3'
Posted On 2015-06-24