Mutagenetix > Incidental Mutations

Incidental Mutation 'R4342:Slc22a12'

324209

Institutional Source

Beutler Lab

Gene Symbol

Slc22a12

Ensembl Gene

ENSMUSG00000061742

Gene Name

solute carrier family 22 (organic anion/cation transporter), member 12

Synonyms

Rst, URAT1

MMRRC Submission

041100-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6535845-6543019 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6541099 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 156 (I156T)

Ref Sequence

ENSEMBL: ENSMUSP00000109078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113451
AA Change: I156T

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: I156T

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	95	525	2e-26	PFAM
Pfam:MFS_1	128	484	7.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113459

SMART Domains

Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
LamG	111	238	1.26e-19	SMART
low complexity region	267	297	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000126142
AA Change: I142T

SMART Domains

Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: I142T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
transmembrane domain	229	248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153483

Meta Mutation Damage Score

0.1345

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Pla2g4e	T	C	2: 120,186,446		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Slc22a12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02033:Slc22a12	APN	19	6537814	missense	probably benign	0.19
IGL02586:Slc22a12	APN	19	6540457	missense	probably benign	0.03
mutual	UTSW	19	6542653	nonsense	probably null
reinforcement	UTSW	19	6537169	missense	probably benign	0.03
R1353:Slc22a12	UTSW	19	6537782	missense	possibly damaging	0.66
R1757:Slc22a12	UTSW	19	6536731	splice site	probably null
R1816:Slc22a12	UTSW	19	6542653	nonsense	probably null
R2254:Slc22a12	UTSW	19	6542541	missense	possibly damaging	0.86
R4110:Slc22a12	UTSW	19	6540628	missense	probably damaging	1.00
R4125:Slc22a12	UTSW	19	6538788	missense	probably damaging	0.99
R4762:Slc22a12	UTSW	19	6538444	missense	probably benign	0.02
R4927:Slc22a12	UTSW	19	6537761	missense	probably benign	0.23
R5690:Slc22a12	UTSW	19	6536848	missense	probably benign	0.00
R5772:Slc22a12	UTSW	19	6540449	missense	possibly damaging	0.67
R5946:Slc22a12	UTSW	19	6537851	missense	probably damaging	1.00
R6137:Slc22a12	UTSW	19	6542724	missense	probably benign	0.07
R7740:Slc22a12	UTSW	19	6537169	missense	probably benign	0.03
R7978:Slc22a12	UTSW	19	6536908	missense	possibly damaging	0.84
R8028:Slc22a12	UTSW	19	6538439	missense	probably benign	0.15
R8508:Slc22a12	UTSW	19	6542437	missense	probably benign	0.03
R8992:Slc22a12	UTSW	19	6542484	missense	possibly damaging	0.62
X0062:Slc22a12	UTSW	19	6537127	missense	probably damaging	1.00
Z1088:Slc22a12	UTSW	19	6538463	missense	possibly damaging	0.54
Z1177:Slc22a12	UTSW	19	6540401	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCGTTAGCAAGTGAATTCCC -3'
(R):5'- ACGCAGTATAGGGCTGACAG -3'

Sequencing Primer
(F):5'- AGTGAATTCCCCCTTAGCAGAGG -3'
(R):5'- CAGTATAGGGCTGACAGGATACTCC -3'

Posted On

2015-06-24