Incidental Mutation 'R4343:Olfr1009'
ID324215
Institutional Source Beutler Lab
Gene Symbol Olfr1009
Ensembl Gene ENSMUSG00000043226
Gene Nameolfactory receptor 1009
SynonymsMOR175-3, GA_x6K02T2Q125-47195323-47196267
MMRRC Submission 041665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4343 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85715419-85725136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85722248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 281 (V281E)
Ref Sequence ENSEMBL: ENSMUSP00000150450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055517] [ENSMUST00000216443]
Predicted Effect probably damaging
Transcript: ENSMUST00000055517
AA Change: V281E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061475
Gene: ENSMUSG00000043226
AA Change: V281E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-55 PFAM
Pfam:7tm_1 41 290 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213600
Predicted Effect probably damaging
Transcript: ENSMUST00000216443
AA Change: V281E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Olfr1009
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Olfr1009 APN 2 85722239 missense probably damaging 1.00
IGL01862:Olfr1009 APN 2 85722128 missense probably damaging 0.99
IGL02868:Olfr1009 APN 2 85721575 missense probably benign 0.19
IGL02904:Olfr1009 APN 2 85721755 missense probably damaging 0.99
IGL03240:Olfr1009 APN 2 85722331 nonsense probably null
IGL03347:Olfr1009 APN 2 85721807 missense probably benign 0.01
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1446:Olfr1009 UTSW 2 85721573 missense probably damaging 0.99
R3782:Olfr1009 UTSW 2 85721696 missense probably damaging 1.00
R4836:Olfr1009 UTSW 2 85721449 missense probably benign
R4845:Olfr1009 UTSW 2 85721492 nonsense probably null
R5490:Olfr1009 UTSW 2 85722322 missense probably benign 0.01
R5534:Olfr1009 UTSW 2 85721987 missense probably benign 0.35
R5679:Olfr1009 UTSW 2 85722046 missense probably damaging 1.00
R6476:Olfr1009 UTSW 2 85721584 missense probably damaging 1.00
R6701:Olfr1009 UTSW 2 85722331 missense probably benign 0.28
R7024:Olfr1009 UTSW 2 85721608 missense probably damaging 1.00
R7140:Olfr1009 UTSW 2 85721474 missense probably damaging 0.97
R7174:Olfr1009 UTSW 2 85721953 missense possibly damaging 0.81
R8079:Olfr1009 UTSW 2 85722043 missense probably benign 0.07
R8082:Olfr1009 UTSW 2 85721480 missense probably benign 0.01
R8213:Olfr1009 UTSW 2 85721501 missense probably null 1.00
X0020:Olfr1009 UTSW 2 85721978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTACCACCATCATAGTCTCCTAC -3'
(R):5'- TGTCATGTTGAGATGCTGCC -3'

Sequencing Primer
(F):5'- ACATCCTCATTGCCATCCTGAGAATC -3'
(R):5'- CCTAGGGGGATCAGATCATGTC -3'
Posted On2015-06-24