Incidental Mutation 'R4343:Tyrp1'
ID324217
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
MMRRC Submission 041665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4343 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80849841 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000119167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133932]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006151
AA Change: D458G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: D458G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102831
AA Change: D458G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: D458G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133932
AA Change: D92G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119167
Gene: ENSMUSG00000005994
AA Change: D92G

DomainStartEndE-ValueType
Pfam:Tyrosinase 1 51 1e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
R7275:Tyrp1 UTSW 4 80837584 missense possibly damaging 0.78
R7684:Tyrp1 UTSW 4 80840625 missense probably damaging 1.00
R7980:Tyrp1 UTSW 4 80840627 missense probably damaging 1.00
R8001:Tyrp1 UTSW 4 80840670 missense probably benign 0.10
R8051:Tyrp1 UTSW 4 80837660 missense probably damaging 1.00
R8233:Tyrp1 UTSW 4 80850953 missense unknown
R8326:Tyrp1 UTSW 4 80850684 missense probably benign 0.06
Z1176:Tyrp1 UTSW 4 80844889 nonsense probably null
Z1177:Tyrp1 UTSW 4 80849817 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCATTAACCACCTTCAG -3'
(R):5'- CAAAGTGAGTACTCCTTAGGTGAC -3'

Sequencing Primer
(F):5'- CCTTCAGAACATAGCAACTACTTTG -3'
(R):5'- GCTTTTGGAGAACACCAC -3'
Posted On2015-06-24