Mutagenetix > Incidental Mutations

Incidental Mutation 'R4343:Ugt2b5'

324220

Institutional Source

Beutler Lab

Gene Symbol

Ugt2b5

Ensembl Gene

ENSMUSG00000054630

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide B5

Synonyms

Udpgt-3, m-1

MMRRC Submission

041665-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R4343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87124960-87140318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87139723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 195 (V195E)

Ref Sequence

ENSEMBL: ENSMUSP00000068282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067790]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067790
AA Change: V195E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: V195E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	527	7.9e-256	PFAM
Pfam:Glyco_tran_28_C	352	449	5.3e-8	PFAM

Meta Mutation Damage Score

0.7022

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Diras1	T	A	10: 81,022,184	K78*	probably null	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm8674	T	A	13: 49,899,706		noncoding transcript	Het
Gnal	T	C	18: 67,135,588	S182P	probably benign	Het
Grik1	T	C	16: 87,896,252	T932A	probably benign	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Mki67	A	G	7: 135,695,118	V2729A	probably benign	Het
Mmp20	GA	GAA	9: 7,628,345		probably null	Het
Myo7b	A	G	18: 31,983,627	F976L	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Npc1l1	G	A	11: 6,217,773	T1006I	probably benign	Het
Olfr1009	T	A	2: 85,722,248	V281E	probably damaging	Het
Plekha5	A	G	6: 140,556,054	E656G	probably damaging	Het
Pqlc1	A	G	18: 80,283,789		probably benign	Het
Prep	C	A	10: 45,120,770	S381R	probably damaging	Het
Rab31	C	T	17: 65,654,419	R192H	probably benign	Het
Rbm5	T	C	9: 107,752,196	D319G	probably damaging	Het
Rexo2	T	C	9: 48,468,848	E228G	possibly damaging	Het
Rrn3	A	G	16: 13,784,122	D80G	probably benign	Het
Slc38a3	A	G	9: 107,656,472	V224A	possibly damaging	Het
Sycp2	T	C	2: 178,380,947	T464A	probably damaging	Het
Tpcn1	A	T	5: 120,560,220	L79H	probably damaging	Het
Trim30a	T	C	7: 104,435,592	Q137R	probably benign	Het
Tyrp1	A	G	4: 80,849,841	D92G	possibly damaging	Het
Ugt1a6a	T	C	1: 88,138,526	L18P	probably damaging	Het
Zmym2	T	A	14: 56,921,562	M598K	probably damaging	Het

Other mutations in Ugt2b5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00702:Ugt2b5	APN	5	87125219	missense	probably benign	0.02
IGL00742:Ugt2b5	APN	5	87127814	missense	probably damaging	1.00
IGL01527:Ugt2b5	APN	5	87136209	missense	possibly damaging	0.71
IGL01530:Ugt2b5	APN	5	87137245	missense	probably benign	0.08
IGL01637:Ugt2b5	APN	5	87139900	missense	probably benign	0.04
IGL02371:Ugt2b5	APN	5	87127676	critical splice donor site	probably null
IGL02993:Ugt2b5	APN	5	87137232	missense	probably damaging	1.00
IGL03114:Ugt2b5	APN	5	87128350	missense	probably damaging	1.00
R0372:Ugt2b5	UTSW	5	87140258	missense	probably benign	0.05
R0568:Ugt2b5	UTSW	5	87137365	critical splice acceptor site	probably benign
R0650:Ugt2b5	UTSW	5	87139768	missense	probably benign	0.00
R1660:Ugt2b5	UTSW	5	87139618	missense	probably benign	0.00
R1907:Ugt2b5	UTSW	5	87139630	missense	probably benign	0.19
R1955:Ugt2b5	UTSW	5	87127772	missense	probably benign	0.18
R2389:Ugt2b5	UTSW	5	87127682	missense	probably damaging	0.98
R2435:Ugt2b5	UTSW	5	87139606	missense	probably damaging	0.99
R2919:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R2920:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R4342:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4344:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4355:Ugt2b5	UTSW	5	87139763	nonsense	probably null
R4380:Ugt2b5	UTSW	5	87127894	missense	probably damaging	1.00
R4789:Ugt2b5	UTSW	5	87139691	missense	probably benign	0.14
R4993:Ugt2b5	UTSW	5	87139673	missense	probably benign	0.00
R5731:Ugt2b5	UTSW	5	87140252	nonsense	probably null
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R6491:Ugt2b5	UTSW	5	87125469	nonsense	probably null
R7015:Ugt2b5	UTSW	5	87139796	missense	probably damaging	1.00
R7203:Ugt2b5	UTSW	5	87128399	missense	possibly damaging	0.72
R7212:Ugt2b5	UTSW	5	87125272	missense	probably benign	0.06
R7750:Ugt2b5	UTSW	5	87140249	missense	probably benign	0.11
R8384:Ugt2b5	UTSW	5	87140065	missense	probably benign
R8465:Ugt2b5	UTSW	5	87139659	missense	possibly damaging	0.79
R9336:Ugt2b5	UTSW	5	87137271	missense	probably benign	0.00
X0004:Ugt2b5	UTSW	5	87128371	nonsense	probably null
X0021:Ugt2b5	UTSW	5	87136211	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGGACTGATACTGATACCTTCTCCTG -3'
(R):5'- GCTCATGACAAAGCTACAGGAATC -3'

Sequencing Primer
(F):5'- CACTTGTGAAACTTAGGTTTTCAAGC -3'
(R):5'- GCTACAGGAATCCAAGTTTGATGTCC -3'

Posted On

2015-06-24