Incidental Mutation 'R4343:Tpcn1'
ID324221
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 041665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4343 (G1)
Quality Score174
Status Not validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120560220 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 79 (L79H)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably damaging
Transcript: ENSMUST00000046426
AA Change: L79H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: L79H

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACACAAGTTCCTATGGCAC -3'
(R):5'- ATTGGCACATGGACAGACTGAC -3'

Sequencing Primer
(F):5'- TGGCACAACCAGGTGAGCTC -3'
(R):5'- TCAAACTATGGGGGCCATTC -3'
Posted On2015-06-24