Incidental Mutation 'R4343:Gm8674'
ID324236
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Namepredicted gene 8674
Synonyms
MMRRC Submission 041665-MU
Accession Numbers

Genbank: XM_990959; MGI: 3645762

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4343 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49899119-49904597 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 49899706 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 49901939 exon noncoding transcript
R0357:Gm8674 UTSW 13 49902113 exon noncoding transcript
R0627:Gm8674 UTSW 13 49899715 exon noncoding transcript
R0833:Gm8674 UTSW 13 49904575 exon noncoding transcript
R1300:Gm8674 UTSW 13 49901722 exon noncoding transcript
R1452:Gm8674 UTSW 13 49900517 exon noncoding transcript
R1542:Gm8674 UTSW 13 49900003 exon noncoding transcript
R1613:Gm8674 UTSW 13 49902438 intron noncoding transcript
R1643:Gm8674 UTSW 13 49901358 exon noncoding transcript
R1732:Gm8674 UTSW 13 49901926 exon noncoding transcript
R1824:Gm8674 UTSW 13 49900808 exon noncoding transcript
R1840:Gm8674 UTSW 13 49901765 exon noncoding transcript
R1915:Gm8674 UTSW 13 49900853 exon noncoding transcript
R1934:Gm8674 UTSW 13 49901435 exon noncoding transcript
R2040:Gm8674 UTSW 13 49901669 exon noncoding transcript
R2214:Gm8674 UTSW 13 49901360 exon noncoding transcript
R2421:Gm8674 UTSW 13 49900663 exon noncoding transcript
R3423:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3425:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3886:Gm8674 UTSW 13 49902163 splice site noncoding transcript
R4083:Gm8674 UTSW 13 49901011 exon noncoding transcript
R4570:Gm8674 UTSW 13 49902534 intron noncoding transcript
R4936:Gm8674 UTSW 13 49900755 exon noncoding transcript
R4967:Gm8674 UTSW 13 49901998 exon noncoding transcript
R5065:Gm8674 UTSW 13 49902577 intron noncoding transcript
R5067:Gm8674 UTSW 13 49899834 exon noncoding transcript
R5120:Gm8674 UTSW 13 49901948 exon noncoding transcript
R5208:Gm8674 UTSW 13 49901921 exon noncoding transcript
R5268:Gm8674 UTSW 13 49901354 exon noncoding transcript
R5471:Gm8674 UTSW 13 49900813 exon noncoding transcript
R5773:Gm8674 UTSW 13 49901876 exon noncoding transcript
R5809:Gm8674 UTSW 13 49901888 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49900794 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49901248 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAATTTCTTTCCCCGTGGGC -3'
(R):5'- TGCTGAGCATACAAAGAAAGTCC -3'

Sequencing Primer
(F):5'- CATGTGGAGCTGGTCAAAGCAC -3'
(R):5'- GCATACAAAGAAAGTCCCAACAAGG -3'
Posted On2015-06-24