Incidental Mutation 'R4343:Rrn3'
ID324238
Institutional Source Beutler Lab
Gene Symbol Rrn3
Ensembl Gene ENSMUSG00000022682
Gene NameRRN3 RNA polymerase I transcription factor homolog (yeast)
SynonymsTIF-1A, E130302O19Rik
MMRRC Submission 041665-MU
Accession Numbers

Genbank: NM_001039521; MGI: 1925255

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4343 (G1)
Quality Score163
Status Not validated
Chromosome16
Chromosomal Location13780708-13814839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13784122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000023363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023363]
Predicted Effect probably benign
Transcript: ENSMUST00000023363
AA Change: D80G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023363
Gene: ENSMUSG00000022682
AA Change: D80G

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:RRN3 46 584 7.5e-138 PFAM
low complexity region 597 605 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230102
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure to undergo embryonic turning, delayed embryonic development, markedly reduced embryo size, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(36)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Rrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Rrn3 APN 16 13809062 missense probably damaging 1.00
IGL02507:Rrn3 APN 16 13788857 missense probably benign
IGL02607:Rrn3 APN 16 13806563 missense possibly damaging 0.65
IGL02648:Rrn3 APN 16 13811589 missense probably benign
IGL03217:Rrn3 APN 16 13809011 missense possibly damaging 0.83
IGL03403:Rrn3 APN 16 13799945 nonsense probably null
11287:Rrn3 UTSW 16 13800019 splice site probably null
ANU74:Rrn3 UTSW 16 13811533 missense possibly damaging 0.65
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0308:Rrn3 UTSW 16 13799882 splice site probably benign
R1970:Rrn3 UTSW 16 13789074 missense probably damaging 1.00
R3712:Rrn3 UTSW 16 13784095 nonsense probably null
R3959:Rrn3 UTSW 16 13782100 critical splice donor site probably null
R4678:Rrn3 UTSW 16 13796076 missense probably damaging 1.00
R4920:Rrn3 UTSW 16 13790639 missense probably benign 0.01
R4925:Rrn3 UTSW 16 13799972 missense probably damaging 1.00
R5225:Rrn3 UTSW 16 13792934 splice site probably null
R5469:Rrn3 UTSW 16 13813100 missense probably benign 0.01
R5702:Rrn3 UTSW 16 13813266 nonsense probably null
R6059:Rrn3 UTSW 16 13806604 missense probably benign
R6425:Rrn3 UTSW 16 13811601 missense probably benign 0.00
R7582:Rrn3 UTSW 16 13810511 nonsense probably null
R7814:Rrn3 UTSW 16 13811589 missense probably benign
Z1176:Rrn3 UTSW 16 13813156 missense probably damaging 1.00
Z1177:Rrn3 UTSW 16 13788846 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGATATGTAGACGTTTCATGGTTCC -3'
(R):5'- AAGGAGTCCTGCCCTTCAAC -3'

Sequencing Primer
(F):5'- CATGGTTCCTTTTGTAGTTCCATGAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-06-24