Incidental Mutation 'R0004:Pcdhb10'
ID32424
Institutional Source Beutler Lab
Gene Symbol Pcdhb10
Ensembl Gene ENSMUSG00000045657
Gene Nameprotocadherin beta 10
SynonymsPcdhb5D, PcdhbJ
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location37411664-37414514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37411959 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 29 (D29E)
Ref Sequence ENSEMBL: ENSMUSP00000056420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051126] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051126
AA Change: D29E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056420
Gene: ENSMUSG00000045657
AA Change: D29E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 5.5e-33 PFAM
CA 155 240 5.59e-23 SMART
CA 264 344 5.17e-27 SMART
CA 367 448 5.59e-23 SMART
CA 472 558 6.62e-25 SMART
CA 588 669 2.03e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Pcdhb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Pcdhb10 APN 18 37412195 missense probably damaging 0.96
IGL01383:Pcdhb10 APN 18 37413275 missense probably benign 0.14
IGL01765:Pcdhb10 APN 18 37414019 missense probably benign 0.00
IGL02240:Pcdhb10 APN 18 37412402 missense possibly damaging 0.90
IGL02548:Pcdhb10 APN 18 37412690 missense probably benign 0.00
IGL02563:Pcdhb10 APN 18 37413073 missense probably benign 0.26
IGL02598:Pcdhb10 APN 18 37413781 missense possibly damaging 0.89
IGL02711:Pcdhb10 APN 18 37412726 missense possibly damaging 0.56
IGL02813:Pcdhb10 APN 18 37413762 missense possibly damaging 0.94
IGL02893:Pcdhb10 APN 18 37413634 missense probably damaging 1.00
IGL03288:Pcdhb10 APN 18 37413305 missense probably damaging 1.00
IGL03310:Pcdhb10 APN 18 37412321 missense probably damaging 0.97
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0389:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0443:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0480:Pcdhb10 UTSW 18 37413099 missense probably damaging 1.00
R1218:Pcdhb10 UTSW 18 37413161 missense probably damaging 1.00
R1448:Pcdhb10 UTSW 18 37412503 missense possibly damaging 0.89
R1737:Pcdhb10 UTSW 18 37412956 missense probably benign 0.01
R2092:Pcdhb10 UTSW 18 37414187 missense probably benign 0.00
R2277:Pcdhb10 UTSW 18 37412624 missense possibly damaging 0.82
R2363:Pcdhb10 UTSW 18 37414137 nonsense probably null
R3826:Pcdhb10 UTSW 18 37412417 missense probably damaging 1.00
R4372:Pcdhb10 UTSW 18 37413313 missense possibly damaging 0.95
R4412:Pcdhb10 UTSW 18 37414141 frame shift probably null
R4760:Pcdhb10 UTSW 18 37411942 missense probably benign 0.05
R4941:Pcdhb10 UTSW 18 37412834 missense probably benign 0.29
R5271:Pcdhb10 UTSW 18 37413169 missense probably benign 0.44
R5643:Pcdhb10 UTSW 18 37413166 missense possibly damaging 0.63
R5851:Pcdhb10 UTSW 18 37412758 missense probably benign 0.00
R6089:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6125:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6189:Pcdhb10 UTSW 18 37412403 missense probably damaging 0.99
R6414:Pcdhb10 UTSW 18 37413845 missense possibly damaging 0.95
R6731:Pcdhb10 UTSW 18 37413476 missense probably benign 0.02
R6999:Pcdhb10 UTSW 18 37413118 missense probably damaging 1.00
R7019:Pcdhb10 UTSW 18 37413003 missense probably damaging 1.00
R7317:Pcdhb10 UTSW 18 37413026 missense possibly damaging 0.67
R7554:Pcdhb10 UTSW 18 37411882 missense probably benign
R7638:Pcdhb10 UTSW 18 37412312 missense probably benign 0.03
R7710:Pcdhb10 UTSW 18 37413601 nonsense probably null
R7763:Pcdhb10 UTSW 18 37411882 missense not run
R7867:Pcdhb10 UTSW 18 37413566 missense probably benign 0.03
R8269:Pcdhb10 UTSW 18 37414009 missense probably benign 0.09
X0024:Pcdhb10 UTSW 18 37412998 missense probably benign 0.12
X0036:Pcdhb10 UTSW 18 37411973 missense probably damaging 1.00
Z1176:Pcdhb10 UTSW 18 37413395 frame shift probably null
Z1177:Pcdhb10 UTSW 18 37412543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAAAAGGGACACTTGGTGGC -3'
(R):5'- AAATTCCCAGTCTCTGCATCCAGC -3'

Sequencing Primer
(F):5'- TCTAGGGGAGAAATCTCCGC -3'
(R):5'- AATAGCCAGCTCTCCAACTC -3'
Posted On2013-05-09