Mutagenetix > Incidental Mutation

Incidental Mutation 'R4343:Igf2r'

324240

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

041665-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R4343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12709511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 982 (E982K)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024599
AA Change: E982K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: E982K

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.1447

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cd38	A	C	5: 43,869,089 (GRCm38)	I72L	probably benign	Het
Diras1	T	A	10: 81,022,184 (GRCm38)	K78*	probably null	Het
Gm5878	G	A	6: 85,125,651 (GRCm38)	R31*	probably null	Het
Gm8674	T	A	13: 49,899,706 (GRCm38)		noncoding transcript	Het
Gnal	T	C	18: 67,135,588 (GRCm38)	S182P	probably benign	Het
Grik1	T	C	16: 87,896,252 (GRCm38)	T932A	probably benign	Het
Lepr	G	A	4: 101,765,152 (GRCm38)		probably null	Het
Mical3	C	A	6: 120,934,838 (GRCm38)	E1083*	probably null	Het
Mki67	A	G	7: 135,695,118 (GRCm38)	V2729A	probably benign	Het
Mmp20	GA	GAA	9: 7,628,345 (GRCm38)		probably null	Het
Myo7b	A	G	18: 31,983,627 (GRCm38)	F976L	probably damaging	Het
Nfasc	A	G	1: 132,631,705 (GRCm38)	F229S	probably damaging	Het
Npc1l1	G	A	11: 6,217,773 (GRCm38)	T1006I	probably benign	Het
Or5g9	T	A	2: 85,722,248 (GRCm38)	V281E	probably damaging	Het
Plekha5	A	G	6: 140,556,054 (GRCm38)	E656G	probably damaging	Het
Prep	C	A	10: 45,120,770 (GRCm38)	S381R	probably damaging	Het
Rab31	C	T	17: 65,654,419 (GRCm38)	R192H	probably benign	Het
Rbm5	T	C	9: 107,752,196 (GRCm38)	D319G	probably damaging	Het
Rexo2	T	C	9: 48,468,848 (GRCm38)	E228G	possibly damaging	Het
Rrn3	A	G	16: 13,784,122 (GRCm38)	D80G	probably benign	Het
Slc38a3	A	G	9: 107,656,472 (GRCm38)	V224A	possibly damaging	Het
Slc66a2	A	G	18: 80,283,789 (GRCm38)		probably benign	Het
Sycp2	T	C	2: 178,380,947 (GRCm38)	T464A	probably damaging	Het
Tpcn1	A	T	5: 120,560,220 (GRCm38)	L79H	probably damaging	Het
Trim30a	T	C	7: 104,435,592 (GRCm38)	Q137R	probably benign	Het
Tyrp1	A	G	4: 80,849,841 (GRCm38)	D92G	possibly damaging	Het
Ugt1a6a	T	C	1: 88,138,526 (GRCm38)	L18P	probably damaging	Het
Ugt2b5	A	T	5: 87,139,723 (GRCm38)	V195E	probably damaging	Het
Zmym2	T	A	14: 56,921,562 (GRCm38)	M598K	probably damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,713,990 (GRCm38)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,739,328 (GRCm38)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,700,358 (GRCm38)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,683,867 (GRCm38)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,704,775 (GRCm38)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,695,374 (GRCm38)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,704,349 (GRCm38)	missense	probably benign
IGL01557:Igf2r	APN	17	12,704,635 (GRCm38)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,683,985 (GRCm38)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,725,415 (GRCm38)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,701,313 (GRCm38)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,683,822 (GRCm38)	missense	probably benign
IGL01839:Igf2r	APN	17	12,705,022 (GRCm38)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,714,911 (GRCm38)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,704,338 (GRCm38)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,693,192 (GRCm38)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,702,005 (GRCm38)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,698,516 (GRCm38)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,748,763 (GRCm38)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,712,087 (GRCm38)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,719,883 (GRCm38)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,692,723 (GRCm38)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,694,120 (GRCm38)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,710,746 (GRCm38)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,726,676 (GRCm38)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,716,672 (GRCm38)	missense	probably damaging	1.00
blunt	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
brusque	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
gruff	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
outlier	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,691,962 (GRCm38)	missense	probably benign
R0165:Igf2r	UTSW	17	12,698,527 (GRCm38)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,683,948 (GRCm38)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,692,064 (GRCm38)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,717,274 (GRCm38)	splice site	probably null
R0722:Igf2r	UTSW	17	12,715,495 (GRCm38)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,692,101 (GRCm38)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,694,124 (GRCm38)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,717,269 (GRCm38)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,691,285 (GRCm38)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,726,309 (GRCm38)	missense	probably benign
R1693:Igf2r	UTSW	17	12,704,316 (GRCm38)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,697,441 (GRCm38)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,704,270 (GRCm38)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,733,903 (GRCm38)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,692,738 (GRCm38)	missense	probably benign
R2060:Igf2r	UTSW	17	12,701,319 (GRCm38)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,698,251 (GRCm38)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,722,208 (GRCm38)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,715,943 (GRCm38)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,722,311 (GRCm38)	splice site	probably null
R2696:Igf2r	UTSW	17	12,695,344 (GRCm38)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,709,468 (GRCm38)	missense	probably benign
R3930:Igf2r	UTSW	17	12,705,829 (GRCm38)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,748,751 (GRCm38)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,702,254 (GRCm38)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,703,465 (GRCm38)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,684,126 (GRCm38)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,701,353 (GRCm38)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,691,877 (GRCm38)	splice site	probably null
R4980:Igf2r	UTSW	17	12,703,360 (GRCm38)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,725,416 (GRCm38)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,693,145 (GRCm38)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,739,334 (GRCm38)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,717,367 (GRCm38)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,698,352 (GRCm38)	splice site	probably null
R5794:Igf2r	UTSW	17	12,709,445 (GRCm38)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,714,113 (GRCm38)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,683,900 (GRCm38)	missense	probably benign
R6396:Igf2r	UTSW	17	12,714,090 (GRCm38)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,701,250 (GRCm38)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,698,618 (GRCm38)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,714,944 (GRCm38)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,714,082 (GRCm38)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,703,376 (GRCm38)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,697,341 (GRCm38)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,718,718 (GRCm38)	missense	probably benign
R7030:Igf2r	UTSW	17	12,733,866 (GRCm38)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,698,325 (GRCm38)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,704,323 (GRCm38)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,714,116 (GRCm38)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,703,484 (GRCm38)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,698,228 (GRCm38)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,710,645 (GRCm38)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,698,273 (GRCm38)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,735,991 (GRCm38)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,739,369 (GRCm38)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,748,704 (GRCm38)	missense	probably benign
R8022:Igf2r	UTSW	17	12,718,795 (GRCm38)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,701,238 (GRCm38)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,692,071 (GRCm38)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,733,860 (GRCm38)	missense	probably benign
R8359:Igf2r	UTSW	17	12,683,861 (GRCm38)	missense	probably benign
R8500:Igf2r	UTSW	17	12,709,441 (GRCm38)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,704,313 (GRCm38)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,704,637 (GRCm38)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,701,244 (GRCm38)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,726,772 (GRCm38)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,716,650 (GRCm38)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,751,293 (GRCm38)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,691,213 (GRCm38)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,739,351 (GRCm38)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,695,353 (GRCm38)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,705,759 (GRCm38)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,698,328 (GRCm38)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,686,754 (GRCm38)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,694,140 (GRCm38)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,726,701 (GRCm38)	missense	probably benign
X0028:Igf2r	UTSW	17	12,704,913 (GRCm38)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,697,399 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGCGGGAGATATGCATATGTC -3'
(R):5'- ACTTAGCCCATTGTTGCTTTGG -3'

Sequencing Primer
(F):5'- GATATGCATATGTCCAAGTGACCCTC -3'
(R):5'- CAATATCTGTGGTGCAATGC -3'

Posted On

2015-06-24