Incidental Mutation 'R4343:Rab31'
ID324241
Institutional Source Beutler Lab
Gene Symbol Rab31
Ensembl Gene ENSMUSG00000056515
Gene NameRAB31, member RAS oncogene family
Synonyms
MMRRC Submission 041665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4343 (G1)
Quality Score200
Status Not validated
Chromosome17
Chromosomal Location65651726-65772752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65654419 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 192 (R192H)
Ref Sequence ENSEMBL: ENSMUSP00000068195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070673]
Predicted Effect probably benign
Transcript: ENSMUST00000070673
AA Change: R192H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068195
Gene: ENSMUSG00000056515
AA Change: R192H

DomainStartEndE-ValueType
RAB 7 170 9.87e-69 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small GTP-binding proteins of the RAB family, such as RAB31, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Slc38a3 A G 9: 107,656,472 V224A possibly damaging Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Rab31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Rab31 APN 17 65722003 splice site probably null
IGL02493:Rab31 APN 17 65717552 missense possibly damaging 0.83
IGL03395:Rab31 APN 17 65696367 missense probably benign 0.02
R1967:Rab31 UTSW 17 65772504 critical splice donor site probably null
R4810:Rab31 UTSW 17 65722003 splice site probably null
R7090:Rab31 UTSW 17 65698017 missense possibly damaging 0.92
R7228:Rab31 UTSW 17 65717553 missense probably benign 0.00
R8056:Rab31 UTSW 17 65717508 missense probably benign 0.33
R8202:Rab31 UTSW 17 65667886 missense probably damaging 1.00
R8330:Rab31 UTSW 17 65696274 missense possibly damaging 0.94
R8708:Rab31 UTSW 17 65667864 critical splice donor site probably benign
R8796:Rab31 UTSW 17 65772534 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAACTGAAGGCCATGTTGCG -3'
(R):5'- CCCCAAGTACTGCTATGTTTTG -3'

Sequencing Primer
(F):5'- TTTGCAGGAAACGTCCCTG -3'
(R):5'- GTTTTGTACCCAAACAGGCTAGC -3'
Posted On2015-06-24