Incidental Mutation 'R4343:Myo7b'
ID 324242
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 041665-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4343 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32116680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 976 (F976L)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: F976L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: F976L

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 44,026,431 (GRCm39) I72L probably benign Het
Diras1 T A 10: 80,858,018 (GRCm39) K78* probably null Het
Gm5878 G A 6: 85,102,633 (GRCm39) R31* probably null Het
Gm8674 T A 13: 50,053,742 (GRCm39) noncoding transcript Het
Gnal T C 18: 67,268,659 (GRCm39) S182P probably benign Het
Grik1 T C 16: 87,693,140 (GRCm39) T932A probably benign Het
Igf2r C T 17: 12,928,398 (GRCm39) E982K possibly damaging Het
Lepr G A 4: 101,622,349 (GRCm39) probably null Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mki67 A G 7: 135,296,847 (GRCm39) V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,346 (GRCm39) probably null Het
Nfasc A G 1: 132,559,443 (GRCm39) F229S probably damaging Het
Npc1l1 G A 11: 6,167,773 (GRCm39) T1006I probably benign Het
Or5g9 T A 2: 85,552,592 (GRCm39) V281E probably damaging Het
Plekha5 A G 6: 140,501,780 (GRCm39) E656G probably damaging Het
Prep C A 10: 44,996,866 (GRCm39) S381R probably damaging Het
Rab31 C T 17: 65,961,414 (GRCm39) R192H probably benign Het
Rbm5 T C 9: 107,629,395 (GRCm39) D319G probably damaging Het
Rexo2 T C 9: 48,380,148 (GRCm39) E228G possibly damaging Het
Rrn3 A G 16: 13,601,986 (GRCm39) D80G probably benign Het
Slc38a3 A G 9: 107,533,671 (GRCm39) V224A possibly damaging Het
Slc66a2 A G 18: 80,327,004 (GRCm39) probably benign Het
Sycp2 T C 2: 178,022,740 (GRCm39) T464A probably damaging Het
Tpcn1 A T 5: 120,698,285 (GRCm39) L79H probably damaging Het
Trim30a T C 7: 104,084,799 (GRCm39) Q137R probably benign Het
Tyrp1 A G 4: 80,768,078 (GRCm39) D92G possibly damaging Het
Ugt1a6a T C 1: 88,066,248 (GRCm39) L18P probably damaging Het
Ugt2b5 A T 5: 87,287,582 (GRCm39) V195E probably damaging Het
Zmym2 T A 14: 57,159,019 (GRCm39) M598K probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCTGAACAATGGGTCGGG -3'
(R):5'- ACGCTTTGAGGTAAGACAGATC -3'

Sequencing Primer
(F):5'- CAATGGGTCGGGGGCAG -3'
(R):5'- GCTAACTGGGACTATCAATGTGC -3'
Posted On 2015-06-24