Incidental Mutation 'R4344:Ccdc187'
ID 324248
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4344 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26280669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 599 (K599I)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: K599I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: K599I

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: K599I
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: K638I
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACATACCCCAGACTGCATGG -3'
(R):5'- AGTAATTCTTTTGTGCAGAGGTCC -3'

Sequencing Primer
(F):5'- TGGGAACAAAAGTGACGATGCC -3'
(R):5'- TTTGTGCAGAGGTCCAGTCCC -3'
Posted On 2015-06-24