Mutagenetix > Incidental Mutation

Incidental Mutation 'R4344:Rasef'

324254

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

041101-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R4344 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73745089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 167 (H167L)

Ref Sequence

ENSEMBL: ENSMUSP00000099901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000058292
AA Change: H239L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: H239L

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102837
AA Change: H167L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: H167L

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222414
AA Change: H320L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.0952

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (39/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,826,748	R5S	possibly damaging	Het
Ccdc187	T	A	2: 26,280,669	K599I	probably damaging	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cep19	C	T	16: 32,107,065	T97M	probably damaging	Het
Ces2a	T	G	8: 104,737,134	D159E	probably damaging	Het
Dcc	G	A	18: 71,374,490	A917V	probably damaging	Het
Dennd6b	G	A	15: 89,188,663	A196V	probably benign	Het
Dlgap3	T	C	4: 127,214,348	S475P	possibly damaging	Het
Doc2a	C	T	7: 126,851,149	P156S	probably damaging	Het
Elmo1	T	A	13: 20,261,552		probably null	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm8251	G	A	1: 44,060,991	L316F	possibly damaging	Het
Klk1b8	C	A	7: 43,945,762		probably benign	Het
Lmcd1	T	A	6: 112,288,007		probably benign	Het
Lyst	T	A	13: 13,698,466	I2750K	probably benign	Het
Muc4	A	G	16: 32,770,292	N2958S	possibly damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ppp1r16b	G	A	2: 158,749,186	V163I	probably damaging	Het
Prkdc	T	A	16: 15,768,022	W2475R	probably damaging	Het
Rad54l	C	T	4: 116,097,354	C684Y	probably damaging	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Sh3bp2	T	C	5: 34,555,542	F165L	possibly damaging	Het
Slc38a9	T	C	13: 112,729,215	I482T	probably benign	Het
Tmprss6	T	A	15: 78,459,427		probably null	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttc39c	T	A	18: 12,728,610		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn2r22	C	T	6: 123,637,797	G278D	probably damaging	Het
Wisp2	G	A	2: 163,828,986	V138M	probably damaging	Het
Yme1l1	G	A	2: 23,173,061	A215T	probably benign	Het
Zmynd15	C	T	11: 70,461,068	R38*	probably null	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AGTCACACATTTGGCATCTTTC -3'
(R):5'- TCCCAGATTGTCAGGAAAGCAAAC -3'

Sequencing Primer
(F):5'- CATTTCTTTATACAAATGGGCAGACC -3'
(R):5'- GATTGTCAGGAAAGCAAACTAATTC -3'

Posted On

2015-06-24