Incidental Mutation 'R4344:Cd38'
ID324258
Institutional Source Beutler Lab
Gene Symbol Cd38
Ensembl Gene ENSMUSG00000029084
Gene NameCD38 antigen
SynonymsCd38-rs1
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43868553-43912375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43869089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 72 (I72L)
Ref Sequence ENSEMBL: ENSMUSP00000030964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030964]
PDB Structure
Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030964
AA Change: I72L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084
AA Change: I72L

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Rib_hydrolayse 59 300 2.9e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196600
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Cd38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Cd38 APN 5 43903597 missense probably benign 0.04
IGL01691:Cd38 APN 5 43903586 splice site probably benign
IGL02585:Cd38 APN 5 43910302 missense probably damaging 1.00
paradiso UTSW 5 43903585 splice site probably null
IGL02796:Cd38 UTSW 5 43906213 missense probably damaging 1.00
R0496:Cd38 UTSW 5 43868891 missense probably damaging 1.00
R0855:Cd38 UTSW 5 43903585 splice site probably null
R1621:Cd38 UTSW 5 43901524 missense probably benign 0.00
R2353:Cd38 UTSW 5 43908011 critical splice donor site probably null
R2366:Cd38 UTSW 5 43903590 splice site probably benign
R2860:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R2861:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R4342:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4343:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4953:Cd38 UTSW 5 43907545 missense possibly damaging 0.73
R5007:Cd38 UTSW 5 43906164 missense probably damaging 1.00
R5371:Cd38 UTSW 5 43868883 missense probably benign 0.01
R5699:Cd38 UTSW 5 43900386 missense probably damaging 1.00
R6857:Cd38 UTSW 5 43906198 missense probably damaging 0.99
R6945:Cd38 UTSW 5 43908006 missense probably damaging 1.00
R7129:Cd38 UTSW 5 43910309 missense probably benign 0.13
R7825:Cd38 UTSW 5 43901455 missense probably damaging 1.00
R7852:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7855:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7894:Cd38 UTSW 5 43900404 missense probably damaging 1.00
R7935:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7938:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7977:Cd38 UTSW 5 43900404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTATGAATTTAGCCAGGTGTCTG -3'
(R):5'- TGGTAACTTGAACAGGAGACCTTC -3'

Sequencing Primer
(F):5'- TGGGGACAGACCTGGCTG -3'
(R):5'- AGACCTTCCGCTCAGCACTG -3'
Posted On2015-06-24